NEU2

NEU2 siRNA

20-abx925758
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEU2 antibody

10R-4959 100 ul
EUR 691
Description: Mouse monoclonal NEU2 antibody

NEU2 antibody

10R-4960 100 ul
EUR 691
Description: Mouse monoclonal NEU2 antibody

NEU2 antibody

10R-4961 100 ul
EUR 726
Description: Mouse monoclonal NEU2 antibody

NEU2 Antibody

1-CSB-PA896716ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEU2. Recognizes NEU2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-NEU2

YF-PA24230 50 ul
EUR 334
Description: Mouse polyclonal to NEU2

NEU2 Polyclonal Antibody

ES10922-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NEU2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEU2 Polyclonal Antibody

ES10922-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NEU2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEU2 Polyclonal Antibody

ABP59449-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NEU2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEU2 from Human, Mouse, Rat. This NEU2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEU2 protein

NEU2 Polyclonal Antibody

ABP59449-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NEU2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEU2 from Human, Mouse, Rat. This NEU2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEU2 protein

NEU2 Polyclonal Antibody

ABP59449-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NEU2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NEU2 from Human, Mouse, Rat. This NEU2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEU2 protein

NEU2 Rabbit pAb

A8137-100ul 100 ul
EUR 308

NEU2 Rabbit pAb

A8137-200ul 200 ul
EUR 459

NEU2 Rabbit pAb

A8137-20ul 20 ul
EUR 183

NEU2 Rabbit pAb

A8137-50ul 50 ul
EUR 223

NEU2 Polyclonal Antibody

31445-100ul 100ul
EUR 252

NEU2 Polyclonal Antibody

31445-50ul 50ul
EUR 187

NEU2 cloning plasmid

CSB-CL896716HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1143
  • Sequence: ATGGCGTCCCTTCCTGTCCTGCAGAAGGAGAGCGTGTTCCAGTCGGGAGCCCATGCCTACAGAATCCCTGCCCTGCTCTACCTGCCTGGGCAGCAGTCCCTGCTGGCCTTCGCGGAACAGCGGGCAAGCAAGAAGGATGAGCACGCAGAGCTGATTGTCCTGCGCAGAGGAGACT
  • Show more
Description: A cloning plasmid for the NEU2 gene.

Anti-NEU2 antibody

STJ110436 100 µl
EUR 277
Description: This gene belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. Expression studies in COS7 cells confirmed that this gene encodes a functional sialidase. Its cytosolic localization was demonstrated by cell fractionation experiments.

Anti-NEU2 antibody

STJ192080 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEU2

Anti-NEU2 (3G9)

YF-MA14415 100 ug
EUR 363
Description: Mouse monoclonal to NEU2

Anti-NEU2 (2E5)

YF-MA14416 100 ug
EUR 363
Description: Mouse monoclonal to NEU2

Anti-NEU2 (3B9)

YF-MA10617 100 ug
EUR 363
Description: Mouse monoclonal to NEU2

NEU2 Polyclonal Conjugated Antibody

C31445 100ul
EUR 397

Mouse NEU2 shRNA Plasmid

20-abx973573
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sialidase-2 (NEU2) Antibody

20-abx005702
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sialidase-2 (NEU2) Antibody

abx026645-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sialidase-2 (NEU2) Antibody

abx026645-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sialidase-2 (NEU2) Antibody

20-abx321070
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human NEU2 shRNA Plasmid

20-abx953159
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEU2 Recombinant Protein (Human)

RP041617 100 ug Ask for price

NEU2 Recombinant Protein (Rat)

RP213713 100 ug Ask for price

NEU2 Recombinant Protein (Mouse)

RP153731 100 ug Ask for price

NEU2 Recombinant Protein (Mouse)

RP153734 100 ug Ask for price

NEU2 Recombinant Protein (Mouse)

RP153737 100 ug Ask for price

NEU2 Recombinant Protein (Mouse)

RP153740 100 ug Ask for price

Polyclonal NEU2 Antibody (N-term)

APR17547G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEU2 (N-term). This antibody is tested and proven to work in the following applications:

Neu2 ORF Vector (Rat) (pORF)

ORF071239 1.0 ug DNA
EUR 506

NEU2 ORF Vector (Human) (pORF)

ORF013873 1.0 ug DNA
EUR 354

Neu2 ORF Vector (Mouse) (pORF)

ORF051245 1.0 ug DNA
EUR 506

Neu2 ORF Vector (Mouse) (pORF)

ORF051246 1.0 ug DNA
EUR 506

Neu2 ORF Vector (Mouse) (pORF)

ORF051247 1.0 ug DNA
EUR 506

Neu2 ORF Vector (Mouse) (pORF)

ORF051248 1.0 ug DNA
EUR 506

NEU2 ELISA Kit (Rat) (OKCD00425)

OKCD00425 96 Wells
EUR 896
Description: Description of target: Catalyzes the removal of sialic acid (N-acetylneuraminic acid) moities from glycoproteins, oligosaccharides and gangliosides.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Molecular cloning and expression of cDNA encoding rat skeletal muscle cytosolic sialidase."_x005F_x005F_x000D_Miyagi T., Konno K., Emori Y., Kawasaki H., Suzuki K., Yasui A., Tsuiki S._x005F_x005F_x000D_J. Biol. Chem. 268:26435-26440(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA], FUNCTION, CATALYTIC ACTIVITY, TISSUE SPECIFICITY. ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Mouse Sialidase- 2, Neu2 ELISA KIT

ELI-36493m 96 Tests
EUR 865

Human Sialidase- 2, NEU2 ELISA KIT

ELI-44057h 96 Tests
EUR 824

Rat Sialidase- 2, Neu2 ELISA KIT

ELI-45670r 96 Tests
EUR 886

NEU2 sgRNA CRISPR Lentivector set (Human)

K1418401 3 x 1.0 ug
EUR 339

Neu2 sgRNA CRISPR Lentivector set (Mouse)

K3003301 3 x 1.0 ug
EUR 339

Neu2 sgRNA CRISPR Lentivector set (Mouse)

K3418801 3 x 1.0 ug
EUR 339

Neu2 sgRNA CRISPR Lentivector set (Rat)

K6762601 3 x 1.0 ug
EUR 339

Monoclonal NEU2 Antibody (monoclonal) (M02), Clone: 3G9

APR17545G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEU2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3G9. This antibody is applicable in E

Monoclonal NEU2 Antibody (monoclonal) (M04), Clone: 2E6

APR17546G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEU2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 2E6. This antibody is applicable in WB, E

NEU2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1418402 1.0 ug DNA
EUR 154

NEU2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1418403 1.0 ug DNA
EUR 154

NEU2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1418404 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3003302 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3003303 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3003304 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3418802 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3418803 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3418804 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6762602 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6762603 1.0 ug DNA
EUR 154

Neu2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6762604 1.0 ug DNA
EUR 154

NEU2 Protein Vector (Human) (pPB-C-His)

PV055489 500 ng
EUR 481

NEU2 Protein Vector (Human) (pPB-N-His)

PV055490 500 ng
EUR 481

NEU2 Protein Vector (Human) (pPM-C-HA)

PV055491 500 ng
EUR 481

NEU2 Protein Vector (Human) (pPM-C-His)

PV055492 500 ng
EUR 481

NEU2 Protein Vector (Rat) (pPB-C-His)

PV284954 500 ng
EUR 603

NEU2 Protein Vector (Rat) (pPB-N-His)

PV284955 500 ng
EUR 603

NEU2 Protein Vector (Rat) (pPM-C-HA)

PV284956 500 ng
EUR 603

NEU2 Protein Vector (Rat) (pPM-C-His)

PV284957 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPB-C-His)

PV204978 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPB-N-His)

PV204979 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPM-C-HA)

PV204980 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPM-C-His)

PV204981 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPB-C-His)

PV204982 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPB-N-His)

PV204983 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPM-C-HA)

PV204984 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPM-C-His)

PV204985 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPB-C-His)

PV204986 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPB-N-His)

PV204987 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPM-C-HA)

PV204988 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPM-C-His)

PV204989 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPB-C-His)

PV204990 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPB-N-His)

PV204991 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPM-C-HA)

PV204992 500 ng
EUR 603

NEU2 Protein Vector (Mouse) (pPM-C-His)

PV204993 500 ng
EUR 603

Neu2 3'UTR GFP Stable Cell Line

TU164006 1.0 ml Ask for price

Neu2 3'UTR Luciferase Stable Cell Line

TU213901 1.0 ml Ask for price

NEU2 3'UTR Luciferase Stable Cell Line

TU015591 1.0 ml
EUR 2333

Neu2 3'UTR Luciferase Stable Cell Line

TU114006 1.0 ml Ask for price

NEU2 3'UTR GFP Stable Cell Line

TU065591 1.0 ml
EUR 2333

Neu2 3'UTR GFP Stable Cell Line

TU263901 1.0 ml Ask for price