EIF4E

eIF4E Antibody

AF6110 200ul
EUR 304
Description: eIF4E Antibody detects endogenous levels of total eIF4E.

EIF4E siRNA

20-abx901689
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4E Antibody

BF0279 200ul
EUR 376
Description: EIF4E antibody detects endogenous levels of total EIF4E.

eIF4E Antibody

AF7702 200ul
EUR 376
Description: eIF4E Antibody detects endogenous levels of eIF4E.

eIF4E Antibody

ABF6110 100 ug
EUR 438

EIF4E siRNA

20-abx915211
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4E siRNA

20-abx915212
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF4E antibody

70R-49697 100 ul
EUR 244
Description: Purified Polyclonal EIF4E antibody

EIF4E antibody

70R-4682 50 ug
EUR 467
Description: Rabbit polyclonal EIF4E antibody raised against the C terminal of EIF4E

Eif4e antibody

70R-9620 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Eif4e antibody

EIF4E Antibody

ABD6885 100 ug
EUR 438

EIF4E antibody

10R-11030 100 ug
EUR 349
Description: Mouse monoclonal EIF4E antibody

EIF4E antibody

10R-6905 100 ul
EUR 691
Description: Mouse monoclonal EIF4E antibody

EIF4E Antibody

32632-100ul 100ul
EUR 252

EIF4E antibody

10R-3955 100 ul
EUR 691
Description: Mouse monoclonal EIF4E antibody

EIF4E antibody

10R-3956 100 ul
EUR 691
Description: Mouse monoclonal EIF4E antibody

EIF4E antibody

10R-3957 100 ul
EUR 726
Description: Mouse monoclonal EIF4E antibody

eIF4E antibody

20R-2073 50 ug
EUR 281
Description: Rabbit polyclonal eIF4E antibody

eIF4E antibody

20R-2389 50 ug
EUR 281
Description: Rabbit polyclonal eIF4E antibody

EIF4E Antibody

DF6885 200ul
EUR 304
Description: EIF4E Antibody detects endogenous levels of total EIF4E.

EIF4E Antibody

1-CSB-PA007556GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF4E. Recognizes EIF4E from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EIF4E Antibody

1-CSB-PA007556LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF4E. Recognizes EIF4E from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EIF4E Antibody

1-CSB-PA002308
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EIF4E. Recognizes EIF4E from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

anti-EIF4E

YF-PA11522 50 ug
EUR 363
Description: Mouse polyclonal to EIF4E

anti-EIF4E

YF-PA23633 50 ul
EUR 334
Description: Mouse polyclonal to EIF4E

eIF4E Blocking Peptide

AF6110-BP 1mg
EUR 195

EIF4E Blocking Peptide

BF0279-BP 1mg
EUR 195

eIF4E Blocking Peptide

AF7702-BP 1mg
EUR 195

EIF4E cloning plasmid

CSB-CL007556HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atggcgactgtcgaaccggaaaccacccctactcctaatcccccgactacagaagaggagaaaacggaatctaatcaggaggttgctaacccagaacactatattaaacatcccctacagaacagatgggcactctggttttttaaaaatgataaaagcaaaacttggcaagcaaa
  • Show more
Description: A cloning plasmid for the EIF4E gene.

eIF4E Polyclonal Antibody

ES2248-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against eIF4E from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

eIF4E Polyclonal Antibody

ES2248-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against eIF4E from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

eIF4E (pS209) Antibody

20-abx119274
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

EIF4E (pS209) Antibody

20-abx000280
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF4E Blocking Peptide

20-abx062572
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

eIF4E Polyclonal Antibody

ABP51249-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human eIF4E around the non-phosphorylation site of S209
  • Applications tips:
Description: A polyclonal antibody for detection of eIF4E from Human, Mouse, Rat, Monkey. This eIF4E antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4E around the non-phosphorylation site of S209

eIF4E Polyclonal Antibody

ABP51249-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human eIF4E around the non-phosphorylation site of S209
  • Applications tips:
Description: A polyclonal antibody for detection of eIF4E from Human, Mouse, Rat, Monkey. This eIF4E antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4E around the non-phosphorylation site of S209

eIF4E Polyclonal Antibody

ABP51249-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human eIF4E around the non-phosphorylation site of S209
  • Applications tips:
Description: A polyclonal antibody for detection of eIF4E from Human, Mouse, Rat, Monkey. This eIF4E antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human eIF4E around the non-phosphorylation site of S209

eIF4E (pS209) Antibody

abx010702-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

EIF4E Antibody (HRP)

20-abx314116
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EIF4E Antibody (FITC)

20-abx314117
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EIF4E Antibody (Biotin)

20-abx314118
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CBP,EIF4E Antibody

abx231323-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

EIF4E Rabbit pAb

A0468-100ul 100 ul
EUR 308

EIF4E Rabbit pAb

A0468-200ul 200 ul
EUR 459

EIF4E Rabbit pAb

A0468-20ul 20 ul
EUR 183

EIF4E Rabbit pAb

A0468-50ul 50 ul
EUR 223

EIF4E Rabbit pAb

A6085-100ul 100 ul
EUR 308

EIF4E Rabbit pAb

A6085-200ul 200 ul
EUR 459

EIF4E Rabbit pAb

A6085-20ul 20 ul
EUR 183

EIF4E Rabbit pAb

A6085-50ul 50 ul
EUR 223

EIF4E Rabbit mAb

A19044-100ul 100 ul
EUR 410

EIF4E Rabbit mAb

A19044-200ul 200 ul
EUR 571

EIF4E Rabbit mAb

A19044-20ul 20 ul
EUR 221

EIF4E Rabbit mAb

A19044-50ul 50 ul
EUR 287

EIF4E Rabbit pAb

A2162-100ul 100 ul
EUR 308

EIF4E Rabbit pAb

A2162-200ul 200 ul
EUR 459

EIF4E Rabbit pAb

A2162-20ul 20 ul
EUR 183

EIF4E Rabbit pAb

A2162-50ul 50 ul
EUR 223

EIF4E Blocking Peptide

33R-9028 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF4E antibody, catalog no. 70R-4682

Eif4e Blocking Peptide

33R-9310 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Eif4e antibody, catalog no. 70R-9620

eIF4E Polyclonal Antibody

40871-100ul 100ul
EUR 252

eIF4E Polyclonal Antibody

40871-50ul 50ul
EUR 187

EIF4E Blocking Peptide

DF6885-BP 1mg
EUR 195

anti-EIF4E (5D11)

LF-MA30552 100 ul
EUR 527
Description: Mouse Monoclonal to EIF4E

Anti-eIF4E antibody

STJ92881 200 µl
EUR 197
Description: Rabbit polyclonal to eIF4E.

Anti-eIF4E antibody

STJ98016 100 µl
EUR 234
Description: Mouse monoclonal to eIF4E.

Anti-EIF4E antibody

STJ23516 100 µl
EUR 277
Description: The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants.

Anti-EIF4E antibody

STJ114889 100 µl
EUR 277
Description: The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants.

Anti-EIF4E antibody

STJ116293 100 µl
EUR 277
Description: The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants.

Phospho-eIF4E (Ser209) Antibody

AF3110 200ul
EUR 304
Description: Phospho-eIF4E (Ser209) Antibody detects endogenous levels of eIF4E only when phosphorylated at Serine 209.