USP2

USP2 antibody
20R-UR010 50 ug
EUR 656
Description: Rabbit polyclonal USP2 antibody
USP2 antibody
70R-21197 50 ul
EUR 435
Description: Rabbit polyclonal USP2 antibody
USP2 Antibody
36169-100ul 100ul
EUR 252
USP2 Antibody
6141-100
EUR 414
USP2 Antibody
1-CSB-PA673833
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
USP2 Antibody
1-CSB-PA155084
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
USP2 Antibody
1-CSB-PA025710ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
USP2 Antibody
1-CSB-PA025710GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
USP2 Antibody
1-CSB-PA025710LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200
USP2 antibody
70R-9737 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP2 antibody
USP2 antibody
70R-9738 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP2 antibody
USP2 siRNA
20-abx905984
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP2 siRNA
20-abx939208
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP2 siRNA
20-abx939209
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-USP2
YF-PA16086 50 ug
EUR 363
Description: Mouse polyclonal to USP2
anti-USP2
YF-PA16087 100 ul
EUR 403
Description: Rabbit polyclonal to USP2
anti-USP2
YF-PA16088 100 ug
EUR 403
Description: Rabbit polyclonal to USP2
USP2 Rabbit pAb
A10399-100ul 100 ul
EUR 308
USP2 Rabbit pAb
A10399-200ul 200 ul
EUR 459
USP2 Rabbit pAb
A10399-20ul 20 ul
EUR 183
USP2 Rabbit pAb
A10399-50ul 50 ul
EUR 223
USP2 Rabbit pAb
A1433-100ul 100 ul
EUR 308
USP2 Rabbit pAb
A1433-200ul 200 ul
EUR 459
USP2 Rabbit pAb
A1433-20ul 20 ul Ask for price
USP2 Rabbit pAb
A1433-50ul 50 ul Ask for price
USP2 Blocking Peptide
33R-5126 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP2 antibody, catalog no. 70R-9738
USP2 Blocking Peptide
33R-6679 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP2 antibody, catalog no. 70R-9737
Polyclonal USP2 Antibody
APR00330G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 . This antibody is tested and proven to work in the following applications:
USP2 Conjugated Antibody
C36169 100ul
EUR 397
USP2 cloning plasmid
CSB-CL025710HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1818
  • Sequence: atgtcccagctctcctccaccctgaagcgctacacagaatcggcccgctacacagatgcccactatgccaagtcgggctatggtgcctacaccccatcctcctatggggccaatctggctgcctccttactggagaaggagaaacttggtttcaagccggtccccaccagcagct
  • Show more
Description: A cloning plasmid for the USP2 gene.
anti- USP2 antibody
FNab09315 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200;IF:1:10-1:100
  • Immunogen: ubiquitin specific peptidase 2
  • Uniprot ID: O75604
  • Gene ID: 10869
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP2
anti- USP2 antibody
FNab09316 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • IF:1:10-1:100
  • Immunogen: ubiquitin specific peptidase 2
  • Uniprot ID: O75604
  • Gene ID: 10869
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP2
Anti-USP2 antibody
PAab09316 100 ug
EUR 386
Anti-USP2 antibody
STJ26059 100 µl
EUR 277
Description: This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.
Anti-USP2 antibody
STJ112435 100 µl
EUR 277
Description: This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.
Anti-USP2 Antibody
A2146-100 100 µg
EUR 389
Polyclonal USP2 Antibody (Internal)
APR02108G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (Internal). This antibody is tested and proven to work in the following applications:
USP2 Antibody, HRP conjugated
1-CSB-PA025710LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP2 Antibody, FITC conjugated
1-CSB-PA025710LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP2 Antibody, Biotin conjugated
1-CSB-PA025710LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
USP2 ELISA KIT|Human
EF004123 96 Tests
EUR 689
Mouse USP2 shRNA Plasmid
20-abx974331
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat USP2 shRNA Plasmid
20-abx987240
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP2 shRNA Plasmid
20-abx956012
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP2 Recombinant Protein (Rat)
RP236057 100 ug Ask for price
USP2 Recombinant Protein (Human)
RP034093 100 ug Ask for price
USP2 Recombinant Protein (Mouse)
RP183365 100 ug Ask for price
USP2 Recombinant Protein (Mouse)
RP183368 100 ug Ask for price
USP2 Recombinant Protein (Mouse)
RP183371 100 ug Ask for price
Polyclonal USP2 Antibody (N-term)
APR04803G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal USP2 Antibody (C-term)
APR04804G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal USP2 Antibody (Ctr S260)
APR04806G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (Ctr S260). This antibody is tested and proven to work in the following applications:
Monoclonal USP2 Antibody, Clone: 1738CT331.50.87
AMM02572G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human USP2. The antibodies are raised in Mouse and are from clone 1738CT331.50.87. This antibody is applicable in WB, E
Usp2 ORF Vector (Mouse) (pORF)
ORF061123 1.0 ug DNA
EUR 506
Usp2 ORF Vector (Mouse) (pORF)
ORF061124 1.0 ug DNA
EUR 506
Usp2 ORF Vector (Mouse) (pORF)
ORF061125 1.0 ug DNA
EUR 506
Usp2 ORF Vector (Rat) (pORF)
ORF078687 1.0 ug DNA
EUR 506
USP2 ORF Vector (Human) (pORF)
ORF011365 1.0 ug DNA
EUR 95
pECMV-Usp2-m-FLAG Plasmid
PVT15133 2 ug
EUR 325
Polyclonal USP2 Antibody (C-term L523)
APR04805G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (C-term L523). This antibody is tested and proven to work in the following applications:
Ubiquitin Specific Peptidase 2 (USP2) Antibody
20-abx116431
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Usp2 sgRNA CRISPR Lentivector set (Rat)
K7088701 3 x 1.0 ug
EUR 339
Usp2 sgRNA CRISPR Lentivector set (Mouse)
K3444501 3 x 1.0 ug
EUR 339
USP2 sgRNA CRISPR Lentivector set (Human)
K2596001 3 x 1.0 ug
EUR 339
Recombinant Ubiquitin Specific Peptidase 2 (USP2)
4-RPF142Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O75604
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.4kDa
  • Isoelectric Point: 9.4
Description: Recombinant Human Ubiquitin Specific Peptidase 2 expressed in: E.coli
Recombinant Ubiquitin Specific Peptidase 2 (USP2)
4-RPF142Mu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88623
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.1kDa
  • Isoelectric Point: 9.7
Description: Recombinant Mouse Ubiquitin Specific Peptidase 2 expressed in: E.coli
Ubiquitin carboxyl-terminal hydrolase 2 (USP2) Antibody
20-abx213805
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
20-abx126766
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031538-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031538-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031539-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031539-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031540-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031540-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx239316-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.