• Home
  • Human STC1(Stanniocalcin 1) ELISA Kit

Human STC1(Stanniocalcin 1) ELISA Kit

797  

Contents

Human STC1(Stanniocalcin 1) ELISA Kit 

Order Now: lieven@gentaur.com

Human Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Hu-96Tests 96 Tests
EUR 723

Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-48Tests 48 Tests
EUR 544

Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-96Tests 96 Tests
EUR 756

Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-48T 48T
EUR 527
  • Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-96T 96T
EUR 688
  • Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-48T 48T
EUR 549
  • Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-96T 96T
EUR 718
  • Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-48Tests 48 Tests
EUR 533

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-96Tests 96 Tests
EUR 740

Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-48Tests 48 Tests
EUR 557

Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-96Tests 96 Tests
EUR 775

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-48Tests 48 Tests
EUR 557

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-96Tests 96 Tests
EUR 774

Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-48Tests 48 Tests
EUR 583

Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-96Tests 96 Tests
EUR 811

Human Stanniocalcin 1 (STC1) ELISA Kit
abx576396-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.

Human STC1/ Stanniocalcin-1 ELISA Kit
E2412Hu 1 Kit
EUR 605

Human Stanniocalcin- 1, STC1 ELISA KIT
ELI-41328h 96 Tests
EUR 824

Human Stanniocalcin 1 (STC1) ELISA Kit
20-abx153168
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-1(STC1) ELISA kit
1-CSB-EL022821HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Stanniocalcin 1 ELISA Kit (STC1)
RK02343 96 Tests
EUR 521

Human Stanniocalcin-1 (STC1)
1-CSB-RP098854h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Human Stanniocalcin-1 (STC1)
1-CSB-RP098874HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Cow Stanniocalcin 1 (STC1) ELISA Kit
abx555794-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Rat Stanniocalcin 1 (STC1) ELISA Kit
abx571149-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
abx576405-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Bovine Stanniocalcin- 1, STC1 ELISA KIT
ELI-13825b 96 Tests
EUR 928

Mouse Stanniocalcin- 1, Stc1 ELISA KIT
ELI-39536m 96 Tests
EUR 865

Rat Stanniocalcin 1 (STC1) ELISA Kit
20-abx156121
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
20-abx154711
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Stanniocalcin-1(STC1) ELISA kit
1-CSB-EL022821MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Stanniocalcin 1 (STC1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Stanniocalcin 1 ELISA Kit (STC1)
RK03214 96 Tests
EUR 521

Stanniocalcin 1 (STC1) Antibody
20-abx132353
  • EUR 328.00
  • EUR 829.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx101392
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx006838
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx028371-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx028371-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx174633
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx306443
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx320305
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx238315-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx241299
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx178466
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx178467
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx178468
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Stanniocalcin 1 (STC1)
4-RPC874Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P52823
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.8kDa
  • Isoelectric Point: 7.3
Description: Recombinant Human Stanniocalcin 1 expressed in: E.coli

Recombinant Stanniocalcin 1 (STC1)
4-RPC874Mu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 54.7kDa
  • Isoelectric Point: 8.9
Description: Recombinant Mouse Stanniocalcin 1 expressed in: E.coli

Human Stanniocalcin 1/STC1 PicoKine ELISA Kit
EK1404 96 wells
EUR 425
Description: For quantitative detection of human STC1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Human STC1 (Stanniocalcin 1)
ELK3332 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Stanniocalcin 1 (STC1) CLIA Kit
20-abx493944
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Stanniocalcin 1 (STC1) Protein
20-abx069167
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse STC1 (Stanniocalcin 1)
ELK6277 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat STC1 (Stanniocalcin 1)
ELK6427 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-48T 48T
EUR 332
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-96T 96T
EUR 539
  • Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Stc1 ELISA Kit| Rat Stanniocalcin-1 ELISA Kit
EF019372 96 Tests
EUR 689

Stc1 ELISA Kit| Mouse Stanniocalcin-1 ELISA Kit
EF016295 96 Tests
EUR 689

STC1 ELISA Kit| Bovine Stanniocalcin-1 ELISA Kit
EF011935 96 Tests
EUR 689

Mouse Stanniocalcin 1 (STC1) CLIA Kit
20-abx493945
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Stanniocalcin 1 (STC1) CLIA Kit
20-abx493946
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Stanniocalcin 1 (STC1) Protein
20-abx655127
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Stanniocalcin 1 (STC1) Protein
20-abx655128
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Stanniocalcin 1 (STC1) Protein
20-abx655129
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stanniocalcin 1 Polyclonal (STC1) Antibody
20-abx116920
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (HRP)
20-abx306444
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (FITC)
20-abx306445
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (Biotin)
20-abx306446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (FITC)
20-abx271148
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Stanniocalcin 1 (STC1) Antibody (Biotin)
20-abx271414
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Anti-Stanniocalcin 1/STC1 Antibody
PA1997 100ug/vial
EUR 294

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human)
4-PAC874Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1)

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC
4-PAC874Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Biotinylated
4-PAC874Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Biotin.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Cy3
4-PAC874Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Cy3.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), FITC
4-PAC874Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with FITC.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), HRP
4-PAC874Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with HRP.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), PE
4-PAC874Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with PE.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig)
4-MAC874Hu22
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1)

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC-Cy7
4-PAC874Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STC1 (Ser28-Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC
4-MAC874Hu22-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Biotinylated
4-MAC874Hu22-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Biotin.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Cy3
4-MAC874Hu22-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Cy3.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), FITC
4-MAC874Hu22-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with FITC.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), HRP
4-MAC874Hu22-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with HRP.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), PE
4-MAC874Hu22-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC-Cy7
4-MAC874Hu22-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ser28-Ala247
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7.

Human Stanniocalcin-2 (STC-2) AssayMax ELISA Kit
ES3731-1 96 Well Plate
EUR 417

Stc1/ Rat Stc1 ELISA Kit
ELI-29283r 96 Tests
EUR 886

STC1 ELISA KIT|Human
EF003296 96 Tests
EUR 689

ELISA kit for Human Stanniocalcin-1,STC-1
EK3747 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

STC1 ELISA Kit (Human) (OKCD00763)
OKCD00763 96 Wells
EUR 831
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 11.6 pg/mL

STC1 ELISA Kit (Human) (OKBB00964)
OKBB00964 96 Wells
EUR 505
Description: Description of target: Stanniocalcin-1 is a glycoprotein which is encoded by the STC1 gene. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. Human Stanniocalcin-1 is a putative molecular biomarker of leukemic microenvironment and the only molecular function known up to date is a SUMO E3 ligase activity in the SUMOylation cycle. STC1 interacts with lots of proteins in the cytoplasm, mitochondria, endoplasmatic reticulum and dot-like fashion in the nucleus. The N-terminal region of STC1 is the function region which is responsible to establish the interaction with its partners, including SUMO1. Low resolution studies shows that STC1 is an anti-parallel homodimer in solution and the cystein 202 is responsible for the dimerization of this protein. All the 5 dissulfide bonds of human STC1 are conserved and have the same profile of fish STC.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

STC-2 Stanniocalcin-2 Human Recombinant Protein
PROTO76061-1 Regular: 10ug
EUR 317
Description: Stanniocalcin-2 Human Recombinant produced in HEK 293 cell line is a single, glycosylated, polypeptide chain containing 289 amino acids and having a total molecular mass of 31.9kDa (calculated). The Stanniocalcin contains four extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-2 is 100% homologous to the amino acid sequence AA 25-302 of the human mature Human Stanniocalcin-2.

Recombinant Human Stanniocalcin-1
7-02332 2µg Ask for price

Recombinant Human Stanniocalcin-1
7-02333 10µg Ask for price

Recombinant Human Stanniocalcin-1
7-02334 100µg Ask for price

Stanniocalcin-1 Protein
20-abx263197
  • EUR 1483.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Human Stanniocalcin-2 (STC2) ELISA Kit
abx575647-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Stanniocalcin-2
EK2997 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human STC2/ Stanniocalcin-2 ELISA Kit
E2413Hu 1 Kit
EUR 605

Human STC2(Stanniocalcin-2) ELISA Kit
EH1394 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: O76061
  • Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Stanniocalcin- 2, STC2 ELISA KIT
ELI-23671h 96 Tests
EUR 824

Human Stanniocalcin 2 (STC2) ELISA Kit
20-abx153169
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Stanniocalcin 2 (STC2) ELISA Kit
abx250668-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Stanniocalcin 2 (STC2) ELISA Kit
DLR-STC2-Hu-48T 48T
EUR 517
  • Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
DLR-STC2-Hu-96T 96T
EUR 673
  • Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin-2(STC2) ELISA kit
CSB-EL022822HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-2(STC2) ELISA kit
1-CSB-EL022822HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2(STC2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-48Tests 48 Tests
EUR 521

Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-96Tests 96 Tests
EUR 723

Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-48Tests 48 Tests
EUR 544

Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-96Tests 96 Tests
EUR 756

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
4-SEF913Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Stanniocalcin 2 elisa. Alternative names of the recognized antigen: STCRP
  • Stanniocalcin-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse Stanniocalcin-1,STC-1
EK3748 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Stanniocalcin-1,STC-1
EK3749 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Stc1 ELISA Kit (Mouse) (OKCD01708)
OKCD01708 96 Wells
EUR 857
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.63 pg/mL

STC1 ELISA Kit (Rat) (OKDD00732)
OKDD00732 96 Wells
EUR 1040
Description: Description of target: Calcium/phosphate-regulating protein; involved in stimulating osteoblast differentiation [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.055 ng/mL

STC1 ELISA Kit (Mouse) (OKCA02193)
OKCA02193 96 Wells
EUR 833
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Anti-Stanniocalcin 1 (1A3)
YF-MA15649 100 ug
EUR 363
Description: Mouse monoclonal to Stanniocalcin 1

Anti-Stanniocalcin 1 (4H4)
YF-MA10890 100 ug
EUR 363
Description: Mouse monoclonal to Stanniocalcin 1

ELISA kit for Human STC2 (Stanniocalcin 2)
E-EL-H2192 1 plate of 96 wells
EUR 534
  • Gentaur's STC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human STC2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human STC2 (Stanniocalcin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human STC2 (Stanniocalcin 2)
ELK3575 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 2 (STC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
  • Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-48T 48T
EUR 332
  • Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-96T 96T
EUR 539
  • Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

STC-1 Stanniocalcin-1 Human Recombinant Protein
PROTP52823 Regular: 10ug
EUR 317
Description: Stanniocalcin-1 Human Recombinant produced in 293 cell line is a single, glycosylated, polypeptide chain containing 240 amino acids and having a total molecular mass of 25.9 kDa. The Stanniocalcin contains two extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-1 is 100% homologous to the amino acid sequence AA 18-247 of the human mature Human Stanniocalcin-1.

Mouse Stanniocalcin-2 (STC2) ELISA Kit
abx515852-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Stanniocalcin-2 (STC2) ELISA Kit
abx515853-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Mouse Stanniocalcin-2
EK2995 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Stanniocalcin-2
EK2996 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Stc2/ Stanniocalcin-2 ELISA Kit
E0948Ra 1 Kit
EUR 646

Mouse Stc2/ Stanniocalcin-2 ELISA Kit
E1422Mo 1 Kit
EUR 632

Mouse Stanniocalcin- 2, Stc2 ELISA KIT
ELI-52696m 96 Tests
EUR 865

Rat Stanniocalcin- 2, Stc2 ELISA KIT
ELI-29857r 96 Tests
EUR 886

Stanniocalcin protein
30R-3175 50 ug
EUR 257
Description: Purified recombinant Stanniocalcin protein

STC1 siRNA
20-abx905324
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STC1 antibody
70R-6215 50 ug
EUR 467
Description: Rabbit polyclonal STC1 antibody raised against the N terminal of STC1

STC1 Antibody
ABD8393 100 ug
EUR 438

STC1 Antibody
40121-100ul 100ul
EUR 252

STC1 protein
30-1376 500 ug
EUR 392
Description: Recombinant STC1 protein

STC1 antibody
70R-20582 50 ul
EUR 435
Description: Rabbit polyclonal STC1 antibody

STC1 Antibody
DF8393 200ul
EUR 304
Description: STC1 Antibody detects endogenous levels of total STC1.

STC1 siRNA
20-abx935425
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STC1 siRNA
20-abx935426
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STC1 Antibody
1-CSB-PA631492
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

STC1 Antibody
1-CSB-PA09889A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC1 Antibody
1-CSB-PA022821ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC1 Antibody
1-CSB-PA022821GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Stc2 ELISA Kit| Rat Stanniocalcin-2 ELISA Kit
EF019373 96 Tests
EUR 689

Stc2 ELISA Kit| Mouse Stanniocalcin-2 ELISA Kit
EF016296 96 Tests
EUR 689

Human Stanniocalcin 2 (STC2) CLIA Kit
20-abx495054
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Recombinant Human Stanniocalcin-2
7-02335 2µg Ask for price

Recombinant Human Stanniocalcin-2
7-02336 10µg Ask for price

Recombinant Human Stanniocalcin-2
7-02337 100µg Ask for price

Human STC1 shRNA Plasmid
20-abx954638
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STC1 Recombinant Protein (Human)
RP030376 100 ug Ask for price

Recombinant (HEK 293) Stanniocalcin-1
RP-596 10 ug
EUR 286

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

STC1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2301402 1.0 ug DNA
EUR 154

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Stanniocalcin-2 Protein
20-abx260786
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Stanniocalcin-2 Protein
20-abx263198
  • EUR 1483.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Stanniocalcin 2 Antibody
DF12324 200ul
EUR 304
Description: Stanniocalcin 2 antibody detects endogenous levels of Stanniocalcin 2.

anti-Stanniocalcin 2
YF-PA15746 50 ul
EUR 363
Description: Mouse polyclonal to Stanniocalcin 2

STC1 Conjugated Antibody
C40121 100ul
EUR 397

STC1 cloning plasmid
CSB-CL022821HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 744
  • Sequence: atgctccaaaactcagcagtgcttctggtgctggtgatcagtgcttctgcaacccatgaggcggagcagaatgactctgtgagccccaggaaatcccgagtggcggctcaaaactcagctgaagtggttcgttgcctcaacagtgctctacaggtcggctgcggggcttttgcatg
  • Show more
Description: A cloning plasmid for the STC1 gene.

STC1 Polyclonal Antibody
ES11126-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STC1 Polyclonal Antibody
ES11126-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- STC1 antibody
FNab08315 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: stanniocalcin 1
  • Uniprot ID: P52823
  • Gene ID: 6781
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STC1

STC1 Polyclonal Antibody
ABP60537-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STC1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein

STC1 Polyclonal Antibody
ABP60537-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STC1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein

STC1 Polyclonal Antibody
ABP60537-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STC1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein

STC1 Polyclonal Antibody
A61178 100 µg
EUR 570.55
Description: reagents widely cited

STC1 Rabbit pAb
A16976-100ul 100 ul
EUR 308

STC1 Rabbit pAb
A16976-200ul 200 ul
EUR 459

STC1 Rabbit pAb
A16976-20ul 20 ul
EUR 183