- Home
- Human STC1(Stanniocalcin 1) ELISA Kit
Human STC1(Stanniocalcin 1) ELISA Kit
Order Now: lieven@gentaur.com
Human Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
DLR-STC1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
RD-STC1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
RDR-STC1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Stanniocalcin 1 (STC1) ELISA Kit |
abx576396-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 1-3 weeks.
|
Human STC1/ Stanniocalcin-1 ELISA Kit |
E2412Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Stanniocalcin 1 (STC1) ELISA Kit |
20-abx153168 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Stanniocalcin-1(STC1) ELISA kit |
CSB-EL022821HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Stanniocalcin-1(STC1) ELISA kit |
1-CSB-EL022821HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 1 (STC1) ELISA Kit |
4-SEC874Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Stanniocalcin 1 ELISA Kit (STC1) |
RK02343 |
Abclonal |
96 Tests |
EUR 521 |
Human Stanniocalcin-1 (STC1) |
1-CSB-RP098854h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 50.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli |
Human Stanniocalcin-1 (STC1) |
1-CSB-RP098874HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 39.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli |
Cow Stanniocalcin 1 (STC1) ELISA Kit |
abx555794-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 1-3 weeks.
|
Rat Stanniocalcin 1 (STC1) ELISA Kit |
abx571149-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
abx576405-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Rat Stanniocalcin 1 (STC1) ELISA Kit |
20-abx156121 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
20-abx154711 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Stanniocalcin-1(STC1) ELISA kit |
CSB-EL022821MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Stanniocalcin-1(STC1) ELISA kit |
1-CSB-EL022821MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Stanniocalcin 1 (STC1) ELISA Kit |
4-SEC874Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
SEC874Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids. |
Rat Stanniocalcin 1 (STC1) ELISA Kit |
4-SEC874Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Stanniocalcin 1 (STC1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Mouse Stanniocalcin 1 ELISA Kit (STC1) |
RK03214 |
Abclonal |
96 Tests |
EUR 521 |
Stanniocalcin 1 (STC1) Antibody |
20-abx132353 |
Abbexa |
-
EUR 328.00
-
EUR 829.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx101392 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx006838 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
abx028371-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
abx028371-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx174633 |
Abbexa |
|
|
|
Stanniocalcin 1 (STC1) Antibody |
20-abx306443 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx320305 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
abx238315-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx241299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody |
20-abx178466 |
Abbexa |
|
|
|
Stanniocalcin 1 (STC1) Antibody |
20-abx178467 |
Abbexa |
|
|
|
Stanniocalcin 1 (STC1) Antibody |
20-abx178468 |
Abbexa |
|
|
|
Recombinant Stanniocalcin 1 (STC1) |
4-RPC874Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P52823
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 56.8kDa
- Isoelectric Point: 7.3
|
Description: Recombinant Human Stanniocalcin 1 expressed in: E.coli |
Recombinant Stanniocalcin 1 (STC1) |
4-RPC874Mu01 |
Cloud-Clone |
-
EUR 510.37
-
EUR 239.00
-
EUR 1638.88
-
EUR 612.96
-
EUR 1125.92
-
EUR 404.00
-
EUR 3947.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 54.7kDa
- Isoelectric Point: 8.9
|
Description: Recombinant Mouse Stanniocalcin 1 expressed in: E.coli |
Human Stanniocalcin 1/STC1 PicoKine ELISA Kit |
EK1404 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human STC1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
ELISA kit for Human STC1 (Stanniocalcin 1) |
ELK3332 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
- Show more
|
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Stanniocalcin-1 (STC1) |
KTE60383-48T |
Abbkine |
48T |
EUR 332 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Stanniocalcin-1 (STC1) |
KTE60383-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Stanniocalcin-1 (STC1) |
KTE60383-96T |
Abbkine |
96T |
EUR 539 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Stanniocalcin 1 (STC1) CLIA Kit |
20-abx493944 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Stanniocalcin 1 (STC1) Protein |
20-abx069167 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse STC1 (Stanniocalcin 1) |
ELK6277 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
- Show more
|
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat STC1 (Stanniocalcin 1) |
ELK6427 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
- Show more
|
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat Stanniocalcin-1 (STC1) |
KTE100136-48T |
Abbkine |
48T |
EUR 332 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Stanniocalcin-1 (STC1) |
KTE100136-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Stanniocalcin-1 (STC1) |
KTE100136-96T |
Abbkine |
96T |
EUR 539 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Stanniocalcin-1 (STC1) |
KTE70268-48T |
Abbkine |
48T |
EUR 332 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Stanniocalcin-1 (STC1) |
KTE70268-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Stanniocalcin-1 (STC1) |
KTE70268-96T |
Abbkine |
96T |
EUR 539 |
- Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Stc1 ELISA Kit| Rat Stanniocalcin-1 ELISA Kit |
EF019372 |
Lifescience Market |
96 Tests |
EUR 689 |
Stc1 ELISA Kit| Mouse Stanniocalcin-1 ELISA Kit |
EF016295 |
Lifescience Market |
96 Tests |
EUR 689 |
STC1 ELISA Kit| Bovine Stanniocalcin-1 ELISA Kit |
EF011935 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse Stanniocalcin 1 (STC1) CLIA Kit |
20-abx493945 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Stanniocalcin 1 (STC1) CLIA Kit |
20-abx493946 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Stanniocalcin 1 (STC1) Protein |
20-abx655127 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Stanniocalcin 1 (STC1) Protein |
20-abx655128 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Stanniocalcin 1 (STC1) Protein |
20-abx655129 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2207.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Stanniocalcin 1 Polyclonal (STC1) Antibody |
20-abx116920 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody (HRP) |
20-abx306444 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody (FITC) |
20-abx306445 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody (Biotin) |
20-abx306446 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stanniocalcin 1 (STC1) Antibody (FITC) |
20-abx271148 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Stanniocalcin 1 (STC1) Antibody (Biotin) |
20-abx271414 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Anti-Stanniocalcin 1/STC1 Antibody |
PA1997 |
BosterBio |
100ug/vial |
EUR 294 |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human) |
4-PAC874Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1) |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC |
4-PAC874Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Biotinylated |
4-PAC874Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Biotin. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Cy3 |
4-PAC874Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Cy3. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), FITC |
4-PAC874Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with FITC. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), HRP |
4-PAC874Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with HRP. |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), PE |
4-PAC874Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with PE. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig) |
4-MAC874Hu22 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1) |
Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC874Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STC1 (Ser28-Ala247)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC |
4-MAC874Hu22-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Biotinylated |
4-MAC874Hu22-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Biotin. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Cy3 |
4-MAC874Hu22-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Cy3. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), FITC |
4-MAC874Hu22-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with FITC. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), HRP |
4-MAC874Hu22-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with HRP. |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), PE |
4-MAC874Hu22-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with PE. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC-Cy7 |
4-MAC874Hu22-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ser28-Ala247
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7. |
Human Stanniocalcin-2 (STC-2) AssayMax ELISA Kit |
ES3731-1 |
AssayPro |
96 Well Plate |
EUR 417 |
ELISA kit for Human Stanniocalcin-1,STC-1 |
EK3747 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
STC1 ELISA Kit (Human) (OKCD00763) |
OKCD00763 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 11.6 pg/mL |
STC1 ELISA Kit (Human) (OKBB00964) |
OKBB00964 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Stanniocalcin-1 is a glycoprotein which is encoded by the STC1 gene. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. Human Stanniocalcin-1 is a putative molecular biomarker of leukemic microenvironment and the only molecular function known up to date is a SUMO E3 ligase activity in the SUMOylation cycle. STC1 interacts with lots of proteins in the cytoplasm, mitochondria, endoplasmatic reticulum and dot-like fashion in the nucleus. The N-terminal region of STC1 is the function region which is responsible to establish the interaction with its partners, including SUMO1. Low resolution studies shows that STC1 is an anti-parallel homodimer in solution and the cystein 202 is responsible for the dimerization of this protein. All the 5 dissulfide bonds of human STC1 are conserved and have the same profile of fish STC.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
STC-2 Stanniocalcin-2 Human Recombinant Protein |
PROTO76061-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Stanniocalcin-2 Human Recombinant produced in HEK 293 cell line is a single, glycosylated, polypeptide chain containing 289 amino acids and having a total molecular mass of 31.9kDa (calculated). The Stanniocalcin contains four extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-2 is 100% homologous to the amino acid sequence AA 25-302 of the human mature Human Stanniocalcin-2. |
Recombinant Human Stanniocalcin-1 |
7-02332 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Stanniocalcin-1 |
7-02333 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Stanniocalcin-1 |
7-02334 |
CHI Scientific |
100µg |
Ask for price |
Stanniocalcin-1 Protein |
20-abx263197 |
Abbexa |
-
EUR 1483.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human Stanniocalcin-2 (STC2) ELISA Kit |
abx575647-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Stanniocalcin-2 |
EK2997 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human STC2/ Stanniocalcin-2 ELISA Kit |
E2413Hu |
Sunlong |
1 Kit |
EUR 605 |
Human STC2(Stanniocalcin-2) ELISA Kit |
EH1394 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: O76061
- Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Stanniocalcin 2 (STC2) ELISA Kit |
20-abx153169 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Stanniocalcin 2 (STC2) ELISA Kit |
abx250668-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Human Stanniocalcin 2 (STC2) ELISA Kit |
DLR-STC2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
DLR-STC2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Stanniocalcin-2(STC2) ELISA kit |
CSB-EL022822HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Stanniocalcin-2(STC2) ELISA kit |
1-CSB-EL022822HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2(STC2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
RD-STC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Stanniocalcin 2 (STC2) ELISA Kit |
RD-STC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Stanniocalcin 2 (STC2) ELISA Kit |
RDR-STC2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Stanniocalcin 2 (STC2) ELISA Kit |
RDR-STC2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Stanniocalcin 2 (STC2) ELISA Kit |
SEF913Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
SEF913Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
SEF913Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
SEF913Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Stanniocalcin 2 (STC2) ELISA Kit |
4-SEF913Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Stanniocalcin 2 elisa. Alternative names of the recognized antigen: STCRP
- Stanniocalcin-related protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Mouse Stanniocalcin-1,STC-1 |
EK3748 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Rat Stanniocalcin-1,STC-1 |
EK3749 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Stc1 ELISA Kit (Mouse) (OKCD01708) |
OKCD01708 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.63 pg/mL |
STC1 ELISA Kit (Rat) (OKDD00732) |
OKDD00732 |
Aviva Systems Biology |
96 Wells |
EUR 1040 |
Description: Description of target: Calcium/phosphate-regulating protein; involved in stimulating osteoblast differentiation [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.055 ng/mL |
STC1 ELISA Kit (Mouse) (OKCA02193) |
OKCA02193 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL |
Anti-Stanniocalcin 1 (1A3) |
YF-MA15649 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Stanniocalcin 1 |
Anti-Stanniocalcin 1 (4H4) |
YF-MA10890 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Stanniocalcin 1 |
ELISA kit for Human STC2 (Stanniocalcin 2) |
E-EL-H2192 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's STC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human STC2. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human STC2 (Stanniocalcin 2) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human STC2 (Stanniocalcin 2) |
ELK3575 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 2 (STC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc
- Show more
|
Description: A sandwich ELISA kit for detection of Stanniocalcin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Stanniocalcin-2 (STC2) |
KTE60384-48T |
Abbkine |
48T |
EUR 332 |
- Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Stanniocalcin-2 (STC2) |
KTE60384-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Stanniocalcin-2 (STC2) |
KTE60384-96T |
Abbkine |
96T |
EUR 539 |
- Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
STC-1 Stanniocalcin-1 Human Recombinant Protein |
PROTP52823 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Stanniocalcin-1 Human Recombinant produced in 293 cell line is a single, glycosylated, polypeptide chain containing 240 amino acids and having a total molecular mass of 25.9 kDa. The Stanniocalcin contains two extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-1 is 100% homologous to the amino acid sequence AA 18-247 of the human mature Human Stanniocalcin-1. |
Mouse Stanniocalcin-2 (STC2) ELISA Kit |
abx515852-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Stanniocalcin-2 (STC2) ELISA Kit |
abx515853-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Stanniocalcin-2 |
EK2995 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Rat Stanniocalcin-2 |
EK2996 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Rat Stc2/ Stanniocalcin-2 ELISA Kit |
E0948Ra |
Sunlong |
1 Kit |
EUR 646 |
Mouse Stc2/ Stanniocalcin-2 ELISA Kit |
E1422Mo |
Sunlong |
1 Kit |
EUR 632 |
Stanniocalcin protein |
30R-3175 |
Fitzgerald |
50 ug |
EUR 257 |
Description: Purified recombinant Stanniocalcin protein |
STC1 siRNA |
20-abx905324 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STC1 antibody |
70R-6215 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal STC1 antibody raised against the N terminal of STC1 |
STC1 Antibody |
40121-100ul |
SAB |
100ul |
EUR 252 |
STC1 protein |
30-1376 |
Fitzgerald |
500 ug |
EUR 392 |
Description: Recombinant STC1 protein |
STC1 antibody |
70R-20582 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal STC1 antibody |
STC1 Antibody |
DF8393 |
Affbiotech |
200ul |
EUR 304 |
Description: STC1 Antibody detects endogenous levels of total STC1. |
STC1 siRNA |
20-abx935425 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STC1 siRNA |
20-abx935426 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STC1 Antibody |
1-CSB-PA631492 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
STC1 Antibody |
1-CSB-PA09889A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
STC1 Antibody |
1-CSB-PA022821ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
STC1 Antibody |
1-CSB-PA022821GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Stc2 ELISA Kit| Rat Stanniocalcin-2 ELISA Kit |
EF019373 |
Lifescience Market |
96 Tests |
EUR 689 |
Stc2 ELISA Kit| Mouse Stanniocalcin-2 ELISA Kit |
EF016296 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Stanniocalcin 2 (STC2) CLIA Kit |
20-abx495054 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Recombinant Human Stanniocalcin-2 |
7-02335 |
CHI Scientific |
2µg |
Ask for price |
Recombinant Human Stanniocalcin-2 |
7-02336 |
CHI Scientific |
10µg |
Ask for price |
Recombinant Human Stanniocalcin-2 |
7-02337 |
CHI Scientific |
100µg |
Ask for price |
Human STC1 shRNA Plasmid |
20-abx954638 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STC1 Recombinant Protein (Human) |
RP030376 |
ABM |
100 ug |
Ask for price |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
STC1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2301402 |
ABM |
1.0 ug DNA |
EUR 154 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Stanniocalcin-2 Protein |
20-abx260786 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin-2 Protein |
20-abx263198 |
Abbexa |
-
EUR 1483.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Stanniocalcin 2 Antibody |
DF12324 |
Affbiotech |
200ul |
EUR 304 |
Description: Stanniocalcin 2 antibody detects endogenous levels of Stanniocalcin 2. |
anti-Stanniocalcin 2 |
YF-PA15746 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Stanniocalcin 2 |
STC1 Conjugated Antibody |
C40121 |
SAB |
100ul |
EUR 397 |
STC1 cloning plasmid |
CSB-CL022821HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 744
- Sequence: atgctccaaaactcagcagtgcttctggtgctggtgatcagtgcttctgcaacccatgaggcggagcagaatgactctgtgagccccaggaaatcccgagtggcggctcaaaactcagctgaagtggttcgttgcctcaacagtgctctacaggtcggctgcggggcttttgcatg
- Show more
|
Description: A cloning plasmid for the STC1 gene. |
STC1 Polyclonal Antibody |
ES11126-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
STC1 Polyclonal Antibody |
ES11126-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
anti- STC1 antibody |
FNab08315 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- Immunogen: stanniocalcin 1
- Uniprot ID: P52823
- Gene ID: 6781
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against STC1 |
STC1 Polyclonal Antibody |
ABP60537-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STC1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein |
STC1 Polyclonal Antibody |
ABP60537-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STC1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein |
STC1 Polyclonal Antibody |
ABP60537-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STC1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein |
STC1 Polyclonal Antibody |
A61178 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
STC1 Rabbit pAb |
A16976-100ul |
Abclonal |
100 ul |
EUR 308 |
STC1 Rabbit pAb |
A16976-200ul |
Abclonal |
200 ul |
EUR 459 |
STC1 Rabbit pAb |
A16976-20ul |
Abclonal |
20 ul |
EUR 183 |