RPS13

RPS13 antibody
70R-19999 50 ul
EUR 435
Description: Rabbit polyclonal RPS13 antibody
RPS13 antibody
70R-2931 50 ug
EUR 467
Description: Rabbit polyclonal RPS13 antibody raised against the middle region of RPS13
RPS13 antibody
70R-3005 50 ug
EUR 467
Description: Rabbit polyclonal RPS13 antibody raised against the N terminal of RPS13
RPS13 antibody
70R-15210 100 ug
EUR 327
Description: Rabbit polyclonal RPS13 antibody
RPS13 Antibody
34330-100ul 100ul
EUR 252
RPS13 Antibody
34330-50ul 50ul
EUR 187
RPS13 Antibody
CSB-PA098295-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS13. Recognizes RPS13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
RPS13 Antibody
CSB-PA098295-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS13. Recognizes RPS13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
RPS13 Antibody
1-CSB-PA040270
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS13. Recognizes RPS13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
RPS13 antibody
70R-33916 100 ug
EUR 327
Description: Rabbit polyclonal RPS13 antibody
RPS13 Antibody
1-CSB-PA02485A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS13. Recognizes RPS13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
RPS13 Antibody
1-CSB-PA020370GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS13. Recognizes RPS13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RPS13 siRNA
20-abx904688
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS13 siRNA
20-abx932039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS13 siRNA
20-abx932040
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS13 Antibody
ABD13243 100 ug
EUR 438
RPS13 Rabbit pAb
A15720-100ul 100 ul
EUR 308
RPS13 Rabbit pAb
A15720-200ul 200 ul
EUR 459
RPS13 Rabbit pAb
A15720-20ul 20 ul
EUR 183
RPS13 Rabbit pAb
A15720-50ul 50 ul
EUR 223
RPS13 Blocking Peptide
33R-4059 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS13 antibody, catalog no. 70R-2931
RPS13 Blocking Peptide
33R-6067 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS13 antibody, catalog no. 70R-3005
RPS13 antibody (biotin)
60R-1471 100 ug
EUR 327
Description: Rabbit polyclonal RPS13 antibody (biotin)
RPS13 antibody (FITC)
60R-1472 100 ug
EUR 327
Description: Rabbit polyclonal RPS13 antibody (FITC)
RPS13 antibody (HRP)
60R-1473 100 ug
EUR 327
Description: Rabbit polyclonal RPS13 antibody (HRP)
RPS13 Blocking Peptide
20-abx061082
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPS13 Conjugated Antibody
C34330 100ul
EUR 397
RPS13 cloning plasmid
CSB-CL020370HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atgggtcgcatgcatgctcccgggaagggcctgtcccagtcggctttaccctatcgacgcagcgtccccacttggttgaagttgacatctgacgacgtgaaggagcagatttacaaactggccaagaagggccttactccttcacagatcggtgtaatcctgagagattcacatgg
  • Show more
Description: A cloning plasmid for the RPS13 gene.
RPS13 Rabbit pAb
A9207-100ul 100 ul
EUR 308
RPS13 Rabbit pAb
A9207-200ul 200 ul
EUR 459
RPS13 Rabbit pAb
A9207-20ul 20 ul Ask for price
RPS13 Rabbit pAb
A9207-50ul 50 ul Ask for price
RPS13 Polyclonal Antibody
A51576 100 µg
EUR 570.55
Description: fast delivery possible
anti- RPS13 antibody
FNab07459 100µg
EUR 548.75
  • Immunogen: ribosomal protein S13
  • Uniprot ID: P62277
  • Gene ID: 6207
  • Research Area: Metabolism
Description: Antibody raised against RPS13
Anti-RPS13 antibody
PAab07459 100 ug
EUR 386
pCMV-SPORT6-RPS13
PVT12383 2 ug
EUR 391
Anti-RPS13 antibody
STJ111611 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S15P family of ribosomal proteins. It is located in the cytoplasm. The protein has been shown to bind to the 5.8S rRNA in rat. The gene product of the E. coli ortholog (ribosomal protein S15) functions at early steps in ribosome assembly. This gene is co-transcribed with two U14 small nucleolar RNA genes, which are located in its third and fifth introns. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
Anti-RPS13 antibody
STJ118180 100 µl
EUR 277
RPS13 protein (His tag)
80R-2784 100 ug
EUR 424
Description: Purified recombinant RPS13 protein (His tag)
RPS13 ELISA KIT|Human
EF002617 96 Tests
EUR 689
Rat RPS13 shRNA Plasmid
20-abx987576
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RPS13 shRNA Plasmid
20-abx976471
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS13 Antibody, HRP conjugated
1-CSB-PA02485B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS13. Recognizes RPS13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS13 Antibody, FITC conjugated
1-CSB-PA02485C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS13. Recognizes RPS13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS13 Antibody, Biotin conjugated
1-CSB-PA02485D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS13. Recognizes RPS13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human RPS13 shRNA Plasmid
20-abx954181
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pECMV-3-FLAG-RPS13
PVT12973 2 ug
EUR 703
RPS13 Recombinant Protein (Human)
RP027100 100 ug Ask for price
RPS13 Recombinant Protein (Mouse)
RP169187 100 ug Ask for price
RPS13 Recombinant Protein (Rat)
RP226790 100 ug Ask for price
Ribosomal Protein S13 (RPS13) Antibody
20-abx218364
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S13 (RPS13) Antibody
20-abx115254
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S13 (RPS13) Antibody
20-abx123501
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S13 (RPS13) Antibody
20-abx133500
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S13 (RPS13) Antibody
20-abx014093
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Ribosomal Protein S13 (RPS13) Antibody
abx032312-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ribosomal Protein S13 (RPS13) Antibody
abx032312-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ribosomal Protein S13 (RPS13) Antibody
abx237459-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ribosomal Protein S13 (RPS13) Antibody
abx331606-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Ribosomal Protein S13 (RPS13) Antibody
20-abx328893
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS13 Polyclonal Antibody, Biotin Conjugated
A51573 100 µg
EUR 570.55
Description: kits suitable for this type of research
RPS13 Polyclonal Antibody, FITC Conjugated
A51574 100 µg
EUR 570.55
Description: fast delivery possible
RPS13 Polyclonal Antibody, HRP Conjugated
A51575 100 µg
EUR 570.55
Description: reagents widely cited
Rps13 ORF Vector (Rat) (pORF)
ORF075598 1.0 ug DNA
EUR 506
RPS13 ORF Vector (Human) (pORF)
ORF009034 1.0 ug DNA
EUR 95
Rps13 ORF Vector (Mouse) (pORF)
ORF056397 1.0 ug DNA
EUR 506
Anti-RPS13/Ribosomal Protein S13 Antibody
A06221 100ul
EUR 397
Description: Rabbit Polyclonal RPS13/Ribosomal Protein S13 Antibody. Validated in IHC, WB and tested in Human, Mouse.
Anti-RPS13/Ribosomal Protein S13 Antibody
A06221-1 100ul
EUR 397
Description: Rabbit Polyclonal RPS13/Ribosomal Protein S13 Antibody. Validated in IHC and tested in Human, Mouse, Rat.
Human 40S ribosomal protein S13 (RPS13)
1-CSB-RP024854h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 40S ribosomal protein S13(RPS13),partial expressed in E.coli
Ribosomal Protein S13 (RPS13) Antibody Pair
abx117440-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.
40S Ribosomal Protein S13 (RPS13) Antibody
20-abx109456
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps13 sgRNA CRISPR Lentivector set (Rat)
K6967101 3 x 1.0 ug
EUR 339
RPS13 sgRNA CRISPR Lentivector set (Human)
K2027601 3 x 1.0 ug
EUR 339
Rps13 sgRNA CRISPR Lentivector set (Mouse)
K4710801 3 x 1.0 ug
EUR 339
Ciona intestinalis 40S ribosomal protein S13 (RPS13)
1-CSB-EP816848DTL
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 23.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Ciona intestinalis 40S ribosomal protein S13 (RPS13) expressed in E.coli
Human Ribosomal Protein S13 (RPS13) ELISA Kit
20-abx585091
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Rps13 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6967102 1.0 ug DNA
EUR 154
Rps13 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6967103 1.0 ug DNA
EUR 154
Rps13 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6967104 1.0 ug DNA
EUR 154
RPS13 sgRNA CRISPR Lentivector (Human) (Target 1)
K2027602 1.0 ug DNA
EUR 154
RPS13 sgRNA CRISPR Lentivector (Human) (Target 2)
K2027603 1.0 ug DNA
EUR 154
RPS13 sgRNA CRISPR Lentivector (Human) (Target 3)
K2027604 1.0 ug DNA
EUR 154
Rps13 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4710802 1.0 ug DNA
EUR 154
Rps13 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4710803 1.0 ug DNA
EUR 154
Rps13 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4710804 1.0 ug DNA
EUR 154