CALM1

CALM1 siRNA

20-abx900751
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALM1 Antibody

20-abx329158
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CALM1 siRNA

20-abx910156
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALM1 siRNA

20-abx910157
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALM1 Antibody

ABD6319 100 ug
EUR 438

CALM1 antibody

38212-100ul 100ul
EUR 252

CALM1 antibody

70R-16130 50 ul
EUR 435
Description: Rabbit polyclonal CALM1 antibody

CALM1 Antibody

DF6319 200ul
EUR 304
Description: CALM1 Antibody detects endogenous levels of total CALM1.

CALM1 Antibody

1-CSB-PA001168
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

CALM1 Antibody

1-CSB-PA004445GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, WB

CALM1 Antibody

1-CSB-PA004445HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CALM1 Antibody

1-CSB-PA08284A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CALM1 Antibody

1-CSB-PA08285A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

CALM1 Antibody

1-CSB-PA08287A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

pOTB7-CALM1

PVT18301 2 ug
EUR 231

CALM1 Conjugated Antibody

C38212 100ul
EUR 397

CALM1 cloning plasmid

CSB-CL004445HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 342
  • Sequence: atgaggtcactgggtcagaacccaacagaagctgaattgcaggatatgatcaatgaagtggatgctgatggtaatggcaccattgacttccccgaatttttgactatgatggctagaaaaatgaaagatacagatagtgaagaagaaatccgtgaggcattccgagtctttgacaa
  • Show more
Description: A cloning plasmid for the CALM1 gene.

CALM1 cloning plasmid

CSB-CL004445HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atggctgatcagctgaccgaagaacagattgctgaattcaaggaagccttctccctatttgataaagatggcgatggcaccatcacaacaaaggaacttggaactgtcatgaggtcactgggtcagaacccaacagaagctgaattgcaggatatgatcaatgaagtggatgctga
  • Show more
Description: A cloning plasmid for the CALM1 gene.

CALM1 Rabbit mAb

A10769-100ul 100 ul
EUR 384

CALM1 Rabbit mAb

A10769-200ul 200 ul
EUR 554

CALM1 Rabbit mAb

A10769-20ul 20 ul Ask for price

CALM1 Rabbit mAb

A10769-50ul 50 ul
EUR 265

CALM1 Rabbit pAb

A1185-100ul 100 ul
EUR 308

CALM1 Rabbit pAb

A1185-200ul 200 ul
EUR 459

CALM1 Rabbit pAb

A1185-20ul 20 ul
EUR 183

CALM1 Rabbit pAb

A1185-50ul 50 ul
EUR 223

CALM1 Polyclonal Antibody

A58418 100 µg
EUR 570.55
Description: fast delivery possible

CALM1 Polyclonal Antibody

A51453 100 µg
EUR 570.55
Description: Ask the seller for details

CALM1 Polyclonal Antibody

A55511 100 µg
EUR 570.55
Description: fast delivery possible

CALM1 Polyclonal Antibody

A55759 100 µg
EUR 570.55
Description: kits suitable for this type of research

CALM1 Rabbit pAb

A14711-100ul 100 ul
EUR 308

CALM1 Rabbit pAb

A14711-200ul 200 ul
EUR 459

CALM1 Rabbit pAb

A14711-20ul 20 ul
EUR 183

CALM1 Rabbit pAb

A14711-50ul 50 ul
EUR 223

CALM1 Blocking Peptide

DF6319-BP 1mg
EUR 195

Human Calmodulin (CALM1)

1-CSB-YP004445HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Calmodulin(CALM1) expressed in Yeast

Human Calmodulin (CALM1)

1-CSB-EP004445HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Calmodulin(CALM1) expressed in E.coli

Rat Calmodulin (Calm1)

1-CSB-EP004445RA
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Calmodulin(Calm1) expressed in E.coli

Rat Calmodulin (Calm1)

1-CSB-EP004445RAb1
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Calmodulin(Calm1) expressed in E.coli

pSV40- Calm1- m

PVT11632 2 ug
EUR 273

pCMV-SPORT6-CALM1

PVT13278 2 ug
EUR 391

Anti-CALM1 antibody

STJ22864 100 µl
EUR 277
Description: This gene encodes a member of the EF-hand calcium-binding protein family. It is one of three genes which encode an identical calcium binding protein which is one of the four subunits of phosphorylase kinase. Two pseudogenes have been identified on chromosome 7 and X. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALM1 antibody

STJ116911 100 µl
EUR 277
Description: This gene encodes a member of the EF-hand calcium-binding protein family. It is one of three genes which encode an identical calcium binding protein which is one of the four subunits of phosphorylase kinase. Two pseudogenes have been identified on chromosome 7 and X. Multiple transcript variants encoding different isoforms have been found for this gene.

Recombinant Human Calmodulin/CALM1

C911-10ug 10ug
EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of 50mM NH4HCO3, pH 8.0.

Recombinant Human Calmodulin/CALM1

C911-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of 50mM NH4HCO3, pH 8.0.

Recombinant Human Calmodulin/CALM1

C911-500ug 500ug
EUR 1318
Description: Lyophilized from a 0.2 μm filtered solution of 50mM NH4HCO3, pH 8.0.

Recombinant Human Calmodulin/CALM1

C911-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of 50mM NH4HCO3, pH 8.0.

Rat CALM1 shRNA Plasmid

20-abx984397
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CALM1 ELISA Kit

ELA-E0640h 96 Tests
EUR 824

CALM1 ELISA KIT|Human

EF000290 96 Tests
EUR 689

Calmodulin 1 (CALM1) Antibody

20-abx125302
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calmodulin 1 (CALM1) Antibody

20-abx128032
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calmodulin 1 (CALM1) Antibody

20-abx001099
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calmodulin 1 (CALM1) Antibody

20-abx104773
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calmodulin 1 (CALM1) Antibody

20-abx101065
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calmodulin 1 (CALM1) Antibody

20-abx101066
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calmodulin 1 (CALM1) Antibody

abx033991-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calmodulin 1 (CALM1) Antibody

abx033991-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CALM1 (pT80 / S82) Antibody

20-abx329569
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CALM1 (pT79 / pS81) Antibody

abx333461-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Calmodulin 1 (CALM1) Antibody

20-abx303288
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human CALM1 shRNA Plasmid

20-abx950562
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CALM1 shRNA Plasmid

20-abx969443
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALM1 Antibody, HRP conjugated

1-CSB-PA004445HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALM1 Antibody, FITC conjugated

1-CSB-PA004445HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALM1 Antibody, Biotin conjugated

1-CSB-PA004445HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALM1 Antibody, HRP conjugated

1-CSB-PA08284B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALM1 Antibody, FITC conjugated

1-CSB-PA08284C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALM1 Antibody, Biotin conjugated

1-CSB-PA08284D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALM1 Antibody, HRP conjugated

1-CSB-PA08285B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALM1 Antibody, FITC conjugated

1-CSB-PA08285C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALM1 Antibody, Biotin conjugated

1-CSB-PA08285D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALM1 Antibody, HRP conjugated

1-CSB-PA08287B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALM1 Antibody, FITC conjugated

1-CSB-PA08287C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALM1 Antibody, Biotin conjugated

1-CSB-PA08287D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Recombinant Calmodulin 1 (CALM1)

4-RPD315Ga01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62149
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.1kDa
  • Isoelectric Point: 4.4
Description: Recombinant Chicken Calmodulin 1 expressed in: E.coli

Recombinant Calmodulin 1 (CALM1)

4-RPD315Hu01
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62158
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Calmodulin 1 expressed in: E.coli

Recombinant Calmodulin 1 (CALM1)

4-RPD315Hu02
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62158
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Calmodulin 1 expressed in: E.coli

Recombinant Calmodulin 1 (CALM1)

4-RPD315Ra01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62161
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Calmodulin 1 expressed in: E.coli

CALM1 Recombinant Protein (Human)

RP005476 100 ug Ask for price

CALM1 Recombinant Protein (Human)

RP005479 100 ug Ask for price

CALM1 Recombinant Protein (Rat)

RP192923 100 ug Ask for price

CALM1 Recombinant Protein (Mouse)

RP120830 100 ug Ask for price

Polyclonal CALM1 Antibody (C-term)

APG02336G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALM1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Acetyl-CALM1(K116) Antibody

APG01481G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Acetyl-CALM1(K116) . This antibody is tested and proven to work in the following applications:

Cow Calmodulin (CALM1) ELISA Kit

abx513590-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Calmodulin (CALM1) ELISA Kit

abx513591-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Calmodulin (CALM1) ELISA Kit

abx513593-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Calmodulin (CALM1) ELISA Kit

abx513594-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Calmodulin (CALM1) ELISA Kit

abx576514-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.