RPS12 antibody

70R-33915 100 ug
EUR 327
Description: Rabbit polyclonal RPS12 antibody

RPS12 Antibody

ABD13242 100 ug
EUR 438

RPS12 Antibody

ABD3677 100 ug
EUR 438

RPS12 antibody

38711-100ul 100ul
EUR 252

RPS12 Antibody

34329-100ul 100ul
EUR 252

RPS12 Antibody

34329-50ul 50ul
EUR 187

RPS12 antibody

70R-19998 50 ul
EUR 435
Description: Rabbit polyclonal RPS12 antibody

RPS12 antibody

70R-15178 100 ug
EUR 327
Description: Rabbit polyclonal RPS12 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPS12 Antibody

DF3677 200ul
EUR 304
Description: RPS12 Antibody detects endogenous levels of total RPS12.

RPS12 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS12. Recognizes RPS12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

RPS12 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS12. Recognizes RPS12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

RPS12 Antibody

CSB-PA831134-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS12. Recognizes RPS12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

RPS12 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS12. Recognizes RPS12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

RPS12 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS12. Recognizes RPS12 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RPS12 Conjugated Antibody

C38711 100ul
EUR 397

RPS12 cloning plasmid

CSB-CL020367HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 399
  • Sequence: atggccgaggaaggcattgctgctggaggtgtaatggacgttaatactgctttacaagaggttctgaagactgccctcatccacgatggcctagcacgtggaattcgcgaagctgccaaagccttagacaagcgccaagcccatctttgtgtgcttgcatccaactgtgatgagcc
  • Show more
Description: A cloning plasmid for the RPS12 gene.

anti- RPS12 antibody

FNab07458 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:10 - 1:100
  • Immunogen: ribosomal protein S12
  • Uniprot ID: P25398
  • Gene ID: 6206
  • Research Area: Metabolism
Description: Antibody raised against RPS12

RPS12 Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-RPS12 Antibody

A01040 100ul
EUR 397
Description: Rabbit Polyclonal RPS12 Antibody. Validated in IF, WB and tested in Human.

RPS12 Rabbit pAb

A5890-100ul 100 ul
EUR 308

RPS12 Rabbit pAb

A5890-200ul 200 ul
EUR 459

RPS12 Rabbit pAb

A5890-20ul 20 ul
EUR 183

RPS12 Rabbit pAb

A5890-50ul 50 ul
EUR 223

RPS12 Polyclonal Antibody

A52720 100 µg
EUR 570.55
Description: reagents widely cited

RPS12 antibody (HRP)

60R-1374 100 ug
EUR 327
Description: Rabbit polyclonal RPS12 antibody (HRP)

RPS12 antibody (FITC)

60R-1375 100 ug
EUR 327
Description: Rabbit polyclonal RPS12 antibody (FITC)

RPS12 antibody (biotin)

60R-1376 100 ug
EUR 327
Description: Rabbit polyclonal RPS12 antibody (biotin)

RPS12 Blocking Peptide

DF3677-BP 1mg
EUR 195

Anti-RPS12 antibody

PAab07458 100 ug
EUR 386

Anti-RPS12 antibody

STJ28163 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S12E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal cancers compared to matched normal colonic mucosa has been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.


EF002616 96 Tests
EUR 689

Human RPS12 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPS12 protein (His tag)

80R-2829 100 ug
EUR 327
Description: Purified recombinant RPS12 protein (His tag)

RPS12 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS12. Recognizes RPS12 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPS12 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS12. Recognizes RPS12 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPS12 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS12. Recognizes RPS12 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPS12 Recombinant Protein (Human)

RP027097 100 ug Ask for price

RPS12 Recombinant Protein (Rat)

RP226787 100 ug Ask for price

RPS12 Recombinant Protein (Mouse)

RP169184 100 ug Ask for price

Ribosomal Protein S12 (RPS12) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

abx146439-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

abx027119-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

abx027119-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

abx332255-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ribosomal Protein S12 (RPS12) Antibody

abx237458-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPS12 Polyclonal Antibody, Biotin Conjugated

A52717 100 µg
EUR 570.55
Description: fast delivery possible

RPS12 Polyclonal Antibody, FITC Conjugated

A52718 100 µg
EUR 570.55
Description: reagents widely cited

RPS12 Polyclonal Antibody, HRP Conjugated

A52719 100 µg
EUR 570.55
Description: Ask the seller for details

RPS12 ORF Vector (Human) (pORF)

ORF009033 1.0 ug DNA
EUR 95

Rps12 ORF Vector (Mouse) (pORF)

ORF056396 1.0 ug DNA
EUR 506

Rps12 ORF Vector (Rat) (pORF)

ORF075597 1.0 ug DNA
EUR 506

Ribosomal Protein S12 (RPS12) Antibody Pair

abx117492-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

40S Ribosomal Protein S12 (RPS12) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPS12 sgRNA CRISPR Lentivector set (Human)

K2024301 3 x 1.0 ug
EUR 339

Rps12 sgRNA CRISPR Lentivector set (Mouse)

K4648601 3 x 1.0 ug
EUR 339

Human 40S ribosomal protein S12 (RPS12)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 40S ribosomal protein S12(RPS12) expressed in E.coli

Rps12 sgRNA CRISPR Lentivector set (Rat)

K7009301 3 x 1.0 ug
EUR 339

Human Ribosomal Protein S12 (RPS12) ELISA Kit

abx382941-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RPS12 sgRNA CRISPR Lentivector (Human) (Target 1)

K2024302 1.0 ug DNA
EUR 154

RPS12 sgRNA CRISPR Lentivector (Human) (Target 2)

K2024303 1.0 ug DNA
EUR 154

RPS12 sgRNA CRISPR Lentivector (Human) (Target 3)

K2024304 1.0 ug DNA
EUR 154

Rps12 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4648602 1.0 ug DNA
EUR 154

Rps12 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4648603 1.0 ug DNA
EUR 154

Rps12 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4648604 1.0 ug DNA
EUR 154

Rps12 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7009302 1.0 ug DNA
EUR 154

Rps12 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7009303 1.0 ug DNA
EUR 154

Rps12 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7009304 1.0 ug DNA
EUR 154

RPS12 Ribosomal Protein S12 Human Recombinant Protein

PROTP25398 Regular: 20ug
EUR 317
Description: 800x600 RPS12 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 155 amino acids (1-132 a.a.) and having a molecular mass of 16.9kDa.RPS12 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPS12 Protein Vector (Human) (pPB-C-His)

PV036129 500 ng
EUR 329

RPS12 Protein Vector (Human) (pPB-N-His)

PV036130 500 ng
EUR 329

RPS12 Protein Vector (Human) (pPM-C-HA)

PV036131 500 ng
EUR 329

RPS12 Protein Vector (Human) (pPM-C-His)

PV036132 500 ng
EUR 329

RPS12 Protein Vector (Rat) (pPB-C-His)

PV302386 500 ng
EUR 603

RPS12 Protein Vector (Rat) (pPB-N-His)

PV302387 500 ng
EUR 603

RPS12 Protein Vector (Rat) (pPM-C-HA)

PV302388 500 ng
EUR 603

RPS12 Protein Vector (Rat) (pPM-C-His)

PV302389 500 ng
EUR 603

RPS12 Protein Vector (Mouse) (pPB-C-His)

PV225582 500 ng
EUR 603

RPS12 Protein Vector (Mouse) (pPB-N-His)

PV225583 500 ng
EUR 603

RPS12 Protein Vector (Mouse) (pPM-C-HA)

PV225584 500 ng
EUR 603

RPS12 Protein Vector (Mouse) (pPM-C-His)

PV225585 500 ng
EUR 603