TMB Solution (500 mL Part A & 500 mL Part B)

This is a predefined sub-study of the Endothelial Dysfunction in Resuscitated Cardiac Arrest (ENDO-RCA) trial.

We aim to investigate Iloprost, a prostacyclin analogue, safety by evaluating change in whole blood platelet aggregometry (Multiplate) in out of hospital cardiac arrest (OHCA) patients from baseline to 96-h post randomization.A randomized, placebo controlled double-blinded trial in 46 OHCA patients. Patients were allocated 1:2 to 48 h Iloprost infusion, (1 ng/kg/min) or placebo (saline infusion). Platelet aggregation was determined by platelet aggregation tests ASPI-test (arachidonic acid); TRAP-test (thrombin-receptor activating peptide (TRAP)-6; RISTO test (Ristocetin); ADP test (adenosin diphosphat).

There was no significant difference between the iloprost and placebo groups according to ASPI, TRAP, RISTO and ADP platelet aggregation assays. Further, no significant differences regarding risk of bleeding were found between groups (Risk of bleeding: ASPI <40 U; TRAP <92 U; RISTO <35 U; ADP <50 U).

In conclusion, the iloprost infusion did not influence platelet aggregation as evaluated by the ASPI, TRAP, RISTO and ADP assays. There was no increased risk of bleeding or transfusion therapy. A decline in platelet aggregation was observed for the ASPI and ADP assays during the initial 96 h after OHCA.Trial registration at clinicaltrials.gov (identifier NCT02685618) on 18-02-2016.

HO-PEG-PCL(2K),2K

HE002059-2K-500mg 500mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-COOH,2K

HE084017-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-Ph,2K

HE084081-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-FITC,2K

FL001044-2K-100mg 100mg
EUR 383
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DBCO,2K

MF001048-2K-100mg 100mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-OH,2K

HO002002-2K-10g 10g
EUR 283
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Benhz-PEG-Benhz,2K

HO070070-2K-1g 1g
EUR 306
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SH-PEG-HZ,2K

HE003019-2K-1g1050 1g1050
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NH2-PEG-DBCO, 2K

HE005048-2K-500G 500G
EUR 1110
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NH2-PEG-Galactose,2K

HE005072-2K-1g 1g
EUR 359
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

ACRL-PEG-RGD,2K

HE009074-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-FA,2K

HE041057-2K-100mg 100mg
EUR 520
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-SH,2K

HE048003-2K-100mg 100mg
EUR 642
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-Mal,2K

HE048022-2K-100mg 100mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-NHS,2K

HE048023-2K-100mg 100mg
EUR 691
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-SH,2K

HE057003-2K-100mg 100mg
EUR 371
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-ALD,2K

HE057004-2K-100mg 100mg
EUR 403
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-Alkyne,2K

HE057007-2K-100mg 100mg
EUR 416
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-COOH,2K

HE057017-2K-100mg 100mg
EUR 377
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-NHS,2K

HE057023-2K-100mg 100mg
EUR 377
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-NH2,2K

HE084005-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-OH,2K

FL044002-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-SH,2K

FL044003-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-Alkyne,2K

FL044007-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-COOH,2K

FL044017-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-MAL,2K

FL044022-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-NHS,2K

FL044023-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-FITC,2K

FL044041-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-FA,2K

FL044057-2K-100mg 100mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-Azithromycin,2K

FL044076-2K-100mg 100mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-OH,2K

FL045002-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-SH,2K

FL045003-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-COOH,2K

FL045017-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-Mal,2K

FL045022-2K-50mg 50mg
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-NHS,2K

FL045023-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-Biotin,2K

FL045041-2K-50mg 50mg
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-DSPE,2K

FL045096-2K-100mg 100mg
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-OH,2K

FL077002-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-SH,2K

FL077003-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-COOH,2K

FL077017-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-Mal,2K

FL077022-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-NHS,2K

FL077023-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-Biotin,2K

FL077041-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-SH,2K

FL078003-2K-50mg 50mg
EUR 568
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-COOH,2K

FL078017-2K-50mg 50mg
EUR 470
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-Mal,2K

FL078022-2K-50mg 50mg
EUR 470
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY5.5-PEG-SH,2K

FL079003-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY5.5-PEG-FA,2k

FL079057-2K-100mg 100mg
EUR 790
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY7-PEG-DSPE?2K

FL080096-2K-50mg 50mg
EUR 494
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-FITC,2K

FL096044-2K-100mg 100mg
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SS-C30, 2K

MF001092-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cholesterol-PEG-Mal,2K

LP095022-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cholesterol-PEG-Biotin,2K

LP095041-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CLS-PEG-FITCl,2K

LP095044-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-CLS,2K

LP095057-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Alkyne-PEG-DSPE,2K

LP096007-2K-g g
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-Dopamine, 2K

LP096047-2K-100mg 100mg
EUR 568
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-Galactose,2K

LP096072-2K-1g 1g
EUR 852
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-RGD,2K

LP096074-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-RVG,2K

LP096094-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Monostearate-PEG-COOH,2K

LP101017-2K-g g
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PCL(12K)-PEG-Mal,2K

HE062022-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(1.8K)-PEG-COOH,2K

HE083017-2K-500mg 500mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-COOH,2K

HE085017-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-MAL,2K

HE085022-2K-500mg 500mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-NHS,2K

HE085023-2K-500mg 500mg
EUR 691
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PCL(5K)-PEG-Galactose, 2K

HE116072-2K-G G
EUR 359
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-SP2-AA,2K

LP096105-2K-500mg 500mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(50:50)?8K?-PEG-Mal,2K

HE086022-2K-500mg 500mg
EUR 642
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

2K antibody

10R-7771 500 ug
EUR 565
Description: Mouse monoclonal 2K antibody

2K DNA Marker

20-abx098045
  • EUR 258.00
  • EUR 189.00
  • 2.5 ml
  • 500 ul
  • Shipped within 5-10 working days.

mPEG-OH,2K

33-MF001002-2K
  • EUR 235.00
  • EUR 482.00
  • 10g
  • 50g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SH,2K

33-MF001003-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-CHO,2K

33-MF001004-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AlKyne,2K

33-MF001007-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Alkyene,2K

33-MF001008-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AC,2K

33-MF001009-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-ACA,2K

33-MF001010-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MA,2K

33-MF001011-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GA,2K

33-MF001012-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SA,2K

33-MF001013-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GAA,2K

33-MF001014-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SAA,2K

33-MF001015-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-PA,2K

33-MF001016-2K
  • EUR 494.00
  • EUR 198.00
  • 5G
  • G
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-COOH?2K

33-MF001017-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-IA,2K

33-MF001018-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Hydrazide,2K

33-MF001019-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Silane,2K

33-MF001020-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Epoxide,2K

33-MF001021-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,2K

33-MF001022-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SC,2K

33-MF001023-2K
  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SCM,2K

33-MF001024-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SPA,2K

33-MF001025-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SG,2K

33-MF001027-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SS,2K

33-MF001028-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GAS,2K

33-MF001029-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SAS,2K

33-MF001030-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-NPC,2K

33-MF001034-2K
  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-OPSS,2K

33-MF001035-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Ts,2K

33-MF001038-2K
  • EUR 100.00
  • EUR 198.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-LA,2K

33-MF001039-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Biotin,2K

33-MF001041-2K
  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Dansyl,2K

33-MF001046-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Dopamine,2K

33-MF001047-2K
  • EUR 667.00
  • EUR 1899.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DF,2K

33-MF001051-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Br,2K

33-MF001056-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-FA,2K

33-MF001057-2K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-CLS,2K

33-MF001095-2K
  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DSPE,2K

33-MF001096-2K
  • EUR 211.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DMPE,2K

33-MF001097-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DPPE,2K

33-MF001098-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DLPE,2K

33-MF001099-2K
  • EUR 285.00
  • EUR 753.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AA,2K

33-MF001121-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DOPE,2k

33-LP001100-2K
  • EUR 667.00
  • EUR 1899.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SH-PEG-SH,2K

33-HO003003-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CHO-PEG-CHO,2K

33-HO004004-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AlKyne-PEG-AlKyne,2K

33-HO007007-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Alkyene-PEG-Alkyene,2K

33-HO008008-2K
  • EUR 283.00
  • EUR 747.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AC-PEG-AC,2K

33-HO009009-2K
  • EUR 167.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

ACA-PEG-ACA,2K

33-HO010010-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MA-PEG-MA,2K

33-HO011011-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GA-PEG-GA,2K

33-HO012012-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SA-PEG-SA,2K

33-HO013013-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GAA-PEG-GAA,2K

33-HO014014-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SAA-PEG-SAA,2K

33-HO015015-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PA-PEG-PA,2K

33-HO016016-2K
  • EUR 190.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

COOH-PEG-COOH,2K

33-HO017017-2K
  • EUR 143.00
  • EUR 422.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

IA-PEG-IA,2K

33-HO018018-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

HZ-PEG-HZ,2K

33-HO019019-2K
  • EUR 201.00
  • EUR 503.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Epoxide-PEG-Epoxide,2K

33-HO021021-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,2K

33-HO022022-2K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SC-PEG-SC,2K

33-HO023023-2K
  • EUR 143.00
  • EUR 329.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SCM-PEG-SCM,2K

33-HO024024-2K
  • EUR 167.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SPA-PEG-SPA,2K

33-HO025025-2K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SG-PEG-SG,2K

33-HO027027-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SS-PEG-SS,2K

33-HO028028-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GAS-PEG-GAS,2K

33-HO029029-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SAS-PEG-SAS,2K

33-HO030030-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NPC-PEG-NPC,2K

33-HO034034-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OPSS-PEG-OPSS,2K

33-HO035035-2K
  • EUR 283.00
  • EUR 747.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Tos-PEG-Tos,2k

33-HO038038-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-Biotin,2K

33-HO041041-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-DBCO,2K

33-HO048048-2K
  • EUR 422.00
  • EUR 1083.00
  • 100mg
  • 500mg
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DF-PEG-DF,2K

33-HO051051-2K
  • EUR 375.00
  • EUR 1025.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Br-PEG-Br,2K

33-HO056056-2K
  • EUR 201.00
  • EUR 503.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-DSPE,2K

33-HO096096-2K
  • EUR 491.00
  • EUR 1373.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AA-PEG-AA, 2k

33-HO121121-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-NHS,2K

33-HE002023-2K
  • EUR 322.00
  • EUR 864.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-SCM,2K

33-HE002024-2K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

HO-PEG-AA. 2K

33-HE002121-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

 

Platelet function testing is a cornerstone in the diagnostic investigation of patients with a bleeding history. Multiple electrode aggregometry (MEA) has been shown to detect von Willebrand disease (VWD), platelet function disorders, and drug-induced bleeding disorders. However, there are few studies supporting its successful use in children. We have implemented and used MEA over 3 years in our hemostasis laboratory in order to study its usefulness to supplement and expedite diagnosis.

This is a retrospective, single-center, cohort study of 109 hospitalized children who underwent a laboratory investigation of hemostasis and either had a reported bleeding history or an abnormal bleeding episode.

Plasmatic coagulation testing, blood counts, plasmatic von Willebrand testing, platelet function analyzer (PFA-100), and impedance aggregometry (MEA) were performed in all children. Light transmission aggregometry testing was performed as needed.

In 41 cases (37.6%), a working diagnosis was made; a primary hemostatic disorder was detected in 35 children (VWD (n = 16), platelet disorder (n = 15), and valproic acid therapy-induced bleeding disorder (n = 3), acetylsalicylic acid-related bleeding (n = 1). In patients diagnosed with VWD, MEA ristocetin-induced platelet aggregation test (RISTO) high test revealed abnormally low aggregation in six patients (43.8%); whereas in patients diagnosed with a platelet function disorder, abnormally low values were found by MEA in only three children (20%).

Three of the four children with laboratory evidence of drug-induced platelet dysfunction had abnormalities on MEA.

There were no cases in which an abnormal MEA result was used to make a previously undetermined diagnosis. Retrospectively, MEA has demonstrated limited additional diagnostic value beyond standard laboratory testing for detecting defects of primary hemostasis in children.

RPL32

RPL32 antibody

70R-19980 50 ul
EUR 435
Description: Rabbit polyclonal RPL32 antibody

RPL32 antibody

70R-1471 100 ug
EUR 377
Description: Rabbit polyclonal RPL32 antibody raised against the N terminal of RPL32

RPL32 siRNA

20-abx931958
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL32 siRNA

20-abx931959
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL32 Antibody

1-CSB-PA020237GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL32. Recognizes RPL32 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-RPL32

YF-PA24610 50 ul
EUR 334
Description: Mouse polyclonal to RPL32

RPL32 cloning plasmid

CSB-CL020237HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atggccgccctcagaccccttgtgaagcccaagatcgtcaaaaagagaaccaagaagttcatccggcaccagtcagaccgatatgtcaaaattaagcgtaactggcggaaacccagaggcattgacaacagggttcgtagaagattcaagggccagatcttgatgcccaacattgg
  • Show more
Description: A cloning plasmid for the RPL32 gene.

anti- RPL32 antibody

FNab07433 100µg
EUR 548.75
  • Immunogen: ribosomal protein L32
  • Uniprot ID: P62910
  • Gene ID: 6161
  • Research Area: Metabolism
Description: Antibody raised against RPL32

RPL32 Rabbit pAb

A13001-100ul 100 ul
EUR 308

RPL32 Rabbit pAb

A13001-200ul 200 ul
EUR 459

RPL32 Rabbit pAb

A13001-20ul 20 ul
EUR 183

RPL32 Rabbit pAb

A13001-50ul 50 ul
EUR 223

RPL32 Blocking Peptide

33R-1035 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM166 antibody, catalog no. 70R-9643

RPL32 Polyclonal Antibody

27860-100ul 100ul
EUR 252

RPL32 Polyclonal Antibody

27860-50ul 50ul
EUR 187

Anti-RPL32 antibody

PAab07433 100 ug
EUR 386

pCMV-SPORT6-RPL32

PVT13699 2 ug
EUR 391

Anti-RPL32 antibody

STJ114970 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L32E family of ribosomal proteins. It is located in the cytoplasm. Although some studies have mapped this gene to 3q13.3-q21, it is believed to map to 3p25-p24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding the same protein have been observed for this gene.

Anti-RPL32 (1C3)

YF-MA15248 100 ug
EUR 363
Description: Mouse monoclonal to RPL32

Anti-RPL32 (1B11)

YF-MA15249 100 ug
EUR 363
Description: Mouse monoclonal to RPL32

RPL32 Polyclonal Conjugated Antibody

C27860 100ul
EUR 397

Rat RPL32 shRNA Plasmid

20-abx985300
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL32 ELISA KIT|Human

EF002590 96 Tests
EUR 689

Human RPL32 shRNA Plasmid

20-abx954146
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPL32 shRNA Plasmid

20-abx972497
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL32 Recombinant Protein (Human)

RP026968 100 ug Ask for price

RPL32 Recombinant Protein (Rat)

RP226670 100 ug Ask for price

RPL32 Recombinant Protein (Mouse)

RP169043 100 ug Ask for price

Ribosomal Protein L32 (RPL32) Antibody

20-abx115241
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L32 (RPL32) Antibody

abx146441-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein L32 (RPL32) Antibody

abx237433-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPL32 ORF Vector (Human) (pORF)

ORF008990 1.0 ug DNA
EUR 95

Rpl32 ORF Vector (Mouse) (pORF)

ORF056349 1.0 ug DNA
EUR 506

Rpl32 ORF Vector (Rat) (pORF)

ORF075558 1.0 ug DNA
EUR 506

RPL32 sgRNA CRISPR Lentivector set (Human)

K1966501 3 x 1.0 ug
EUR 339

Rpl32 sgRNA CRISPR Lentivector set (Mouse)

K4399201 3 x 1.0 ug
EUR 339

Rpl32 sgRNA CRISPR Lentivector set (Rat)

K6800501 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L32 (RPL32) ELISA Kit

abx382917-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RPL32 sgRNA CRISPR Lentivector (Human) (Target 1)

K1966502 1.0 ug DNA
EUR 154

RPL32 sgRNA CRISPR Lentivector (Human) (Target 2)

K1966503 1.0 ug DNA
EUR 154

RPL32 sgRNA CRISPR Lentivector (Human) (Target 3)

K1966504 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4399202 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4399203 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4399204 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6800502 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6800503 1.0 ug DNA
EUR 154

Rpl32 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6800504 1.0 ug DNA
EUR 154

RPL32 Protein Vector (Human) (pPB-C-His)

PV035957 500 ng
EUR 329

RPL32 Protein Vector (Human) (pPB-N-His)

PV035958 500 ng
EUR 329

RPL32 Protein Vector (Human) (pPM-C-HA)

PV035959 500 ng
EUR 329

RPL32 Protein Vector (Human) (pPM-C-His)

PV035960 500 ng
EUR 329

RPL32 Protein Vector (Rat) (pPB-C-His)

PV302230 500 ng
EUR 603

RPL32 Protein Vector (Rat) (pPB-N-His)

PV302231 500 ng
EUR 603

RPL32 Protein Vector (Rat) (pPM-C-HA)

PV302232 500 ng
EUR 603

RPL32 Protein Vector (Rat) (pPM-C-His)

PV302233 500 ng
EUR 603

RPL32 Protein Vector (Mouse) (pPB-C-His)

PV225394 500 ng
EUR 603

RPL32 Protein Vector (Mouse) (pPB-N-His)

PV225395 500 ng
EUR 603

RPL32 Protein Vector (Mouse) (pPM-C-HA)

PV225396 500 ng
EUR 603

RPL32 Protein Vector (Mouse) (pPM-C-His)

PV225397 500 ng
EUR 603

Rpl32 3'UTR GFP Stable Cell Line

TU168096 1.0 ml Ask for price

RPL32 3'UTR Luciferase Stable Cell Line

TU021344 1.0 ml
EUR 1521

Rpl32 3'UTR Luciferase Stable Cell Line

TU118096 1.0 ml Ask for price

RPL32 3'UTR GFP Stable Cell Line

TU071344 1.0 ml
EUR 1521

Rpl32 3'UTR Luciferase Stable Cell Line

TU219639 1.0 ml Ask for price

Rpl32 3'UTR GFP Stable Cell Line

TU269639 1.0 ml Ask for price

Rat 60S ribosomal protein L32(RPL32) ELISA kit

E02R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L32(RPL32) ELISA kit

E02R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L32(RPL32) ELISA kit

E02R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit

E03R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit

E03R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L32(RPL32) ELISA kit

E03R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit

E04R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit

E04R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L32(RPL32) ELISA kit

E04R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit

E01R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit

E01R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 60S ribosomal protein L32(RPL32) ELISA kit

E01R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit

E06R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit

E06R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 60S ribosomal protein L32(RPL32) ELISA kit

E06R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit

E07R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit

E07R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 60S ribosomal protein L32(RPL32) ELISA kit

E07R0454-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L32(RPL32) ELISA kit

E08R0454-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 60S ribosomal protein L32(RPL32) ELISA kit

E08R0454-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 60S ribosomal protein L32(RPL32) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RPLP2

Rplp2/ Rat Rplp2 ELISA Kit

ELI-22050r 96 Tests
EUR 886

RPLP2 Antibody

34344-100ul 100ul
EUR 252

RPLP2 Antibody

34344-50ul 50ul
EUR 187

RPLP2 Antibody

42743-100ul 100ul
EUR 252

RPLP2 Antibody

1-CSB-PA048402
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

RPLP2 Antibody

1-CSB-PA558649
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

RPLP2 Antibody

1-CSB-PA040245
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPLP2 antibody

70R-33937 100 ug
EUR 327
Description: Rabbit polyclonal RPLP2 antibody

RPLP2 Antibody

1-CSB-PA020342DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RPLP2 siRNA

20-abx904680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPLP2 siRNA

20-abx932005
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPLP2 siRNA

20-abx932006
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human RPLP2 Antibody

33330-05111 150 ug
EUR 261

Human RPLP2 Protein

abx060053-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

RPLP2 Blocking Peptide

20-abx161426
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RPLP2 Conjugated Antibody

C42743 100ul
EUR 397

RPLP2 Conjugated Antibody

C34344 100ul
EUR 397

RPLP2 cloning plasmid

CSB-CL020342HU-10ug 10ug
EUR 208
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 348
  • Sequence: atgcgctacgtcgcctcctacctgctggctgccctagggggcaactcctcccccagcgccaaggacatcaagaagatcttggacagcgtgggtatcgaggcggacgacgaccggctcaacaaggttatcagtgagctgaatggaaaaaacattgaagacgtcattgcccagggtat
  • Show more
Description: A cloning plasmid for the RPLP2 gene.

RPLP2 Rabbit pAb

A6974-100ul 100 ul
EUR 308

RPLP2 Rabbit pAb

A6974-200ul 200 ul
EUR 459

RPLP2 Rabbit pAb

A6974-20ul 20 ul
EUR 183

RPLP2 Rabbit pAb

A6974-50ul 50 ul
EUR 223

Anti-RPLP2 antibody

STJ29054 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P1. The P2 protein can interact with P0 and P1 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

RPLP2 protein (His tag)

80R-2149 100 ug
EUR 322
Description: Purified recombinant Human RPLP2 protein (His tag)

Mouse RPLP2 shRNA Plasmid

20-abx976023
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPLP2 shRNA Plasmid

20-abx987509
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPLP2 shRNA Plasmid

20-abx954158
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPLP2 Recombinant Protein (Human)

RP027052 100 ug Ask for price

RPLP2 Recombinant Protein (Mouse)

RP169136 100 ug Ask for price

RPLP2 Recombinant Protein (Rat)

RP226739 100 ug Ask for price

Human RPLP2 Antibody (Biotin Conjugate)

33330-05121 150 ug
EUR 369

Polyclonal RPLP2 Antibody (aa21-70)

APR03021G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (aa21-70). This antibody is tested and proven to work in the following applications:

Polyclonal RPLP2 Antibody (N-Term)

APR06160G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal RPLP2 Antibody (N-Term)

APR06953G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (N-Term). This antibody is tested and proven to work in the following applications:

Rplp2 ORF Vector (Rat) (pORF)

ORF075581 1.0 ug DNA
EUR 506

RPLP2 ORF Vector (Human) (pORF)

ORF009018 1.0 ug DNA
EUR 95

Rplp2 ORF Vector (Mouse) (pORF)

ORF056380 1.0 ug DNA
EUR 506

Anti-RPLP2/Ribosomal Protein Lp2 Antibody

A05244-1 100ul
EUR 397
Description: Rabbit Polyclonal RPLP2/Ribosomal Protein Lp2 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Human RPLP2 AssayLite Antibody (FITC Conjugate)

33330-05141 150 ug
EUR 428

Human RPLP2 AssayLite Antibody (RPE Conjugate)

33330-05151 150 ug
EUR 428

Human RPLP2 AssayLite Antibody (APC Conjugate)

33330-05161 150 ug
EUR 428

Human RPLP2 AssayLite Antibody (PerCP Conjugate)

33330-05171 150 ug
EUR 471

Rplp2 sgRNA CRISPR Lentivector set (Rat)

K6952101 3 x 1.0 ug
EUR 339

Rplp2 sgRNA CRISPR Lentivector set (Mouse)

K3175901 3 x 1.0 ug
EUR 339

RPLP2 sgRNA CRISPR Lentivector set (Human)

K1996001 3 x 1.0 ug
EUR 339

Human 60S acidic ribosomal protein P2 (RPLP2)

1-CSB-EP020342HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 15.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S acidic ribosomal protein P2(RPLP2) expressed in E.coli

Human 60S acidic ribosomal protein P2 (RPLP2)

1-CSB-RP023544h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S acidic ribosomal protein P2(RPLP2),partial expressed in E.coli

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6952102 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6952103 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6952104 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3175902 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3175903 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3175904 1.0 ug DNA
EUR 154

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1996002 1.0 ug DNA
EUR 154

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1996003 1.0 ug DNA
EUR 154

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1996004 1.0 ug DNA
EUR 154

RPLP2 Ribosomal Phosphoprotein P2 Human Recombinant Protein

PROTP05387 Regular: 20ug
EUR 317
Description: RPLP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 139 amino acids (1-115 a.a.) and having a molecular mass of 14.2kDa.;RPLP2 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPLP2 Protein Vector (Rat) (pPB-C-His)

PV302322 500 ng
EUR 603

RPLP2 Protein Vector (Rat) (pPB-N-His)

PV302323 500 ng
EUR 603

RPLP2 Protein Vector (Rat) (pPM-C-HA)

PV302324 500 ng
EUR 603

RPLP2 Protein Vector (Rat) (pPM-C-His)

PV302325 500 ng
EUR 603

RPLP2 Protein Vector (Mouse) (pPB-C-His)

PV225518 500 ng
EUR 603

RPLP2 Protein Vector (Mouse) (pPB-N-His)

PV225519 500 ng
EUR 603

RPLP2 Protein Vector (Mouse) (pPM-C-HA)

PV225520 500 ng
EUR 603

RPLP2 Protein Vector (Mouse) (pPM-C-His)

PV225521 500 ng
EUR 603

RPLP2 Protein Vector (Human) (pPB-C-His)

PV036069 500 ng
EUR 329

RPLP2 Protein Vector (Human) (pPB-N-His)

PV036070 500 ng
EUR 329

RPLP2 Protein Vector (Human) (pPM-C-HA)

PV036071 500 ng
EUR 329