RPS24

RPS24 Antibody
45725-100ul 100ul
EUR 252
RPS24 Antibody
45725-50ul 50ul
EUR 187
RPS24 Antibody
DF9120 200ul
EUR 304
Description: RPS24 Antibody detects endogenous levels of total RPS24.
RPS24 antibody
70R-4838 50 ug
EUR 467
Description: Rabbit polyclonal RPS24 antibody raised against the middle region of RPS24
RPS24 Antibody
1-CSB-PA020402GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RPS24. Recognizes RPS24 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RPS24 Antibody
1-CSB-PA020402LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS24. Recognizes RPS24 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
RPS24 siRNA
20-abx904699
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS24 siRNA
20-abx932063
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS24 siRNA
20-abx932064
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS24 Antibody
ABD9120 100 ug
EUR 438
RPS24 Rabbit pAb
A12123-100ul 100 ul
EUR 308
RPS24 Rabbit pAb
A12123-200ul 200 ul
EUR 459
RPS24 Rabbit pAb
A12123-20ul 20 ul
EUR 183
RPS24 Rabbit pAb
A12123-50ul 50 ul
EUR 223
RPS24 Blocking Peptide
33R-3257 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPS24 antibody, catalog no. 70R-4838
RPS24 Blocking Peptide
DF9120-BP 1mg
EUR 195
RPS24 Conjugated Antibody
C45725 100ul
EUR 397
RPS24 cloning plasmid
CSB-CL020402HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 393
  • Sequence: atgaacgacaccgtaactatccgcactagaaagttcatgaccaaccgactacttcagaggaaacaaatggtcattgatgtccttcaccccgggaaggcgacagtgcctaagacagaaattcgggaaaaactagccaaaatgtacaagaccacaccggatgtcatctttgtatttgg
  • Show more
Description: A cloning plasmid for the RPS24 gene.
RPS24 Rabbit pAb
A9044-100ul 100 ul
EUR 308
RPS24 Rabbit pAb
A9044-200ul 200 ul
EUR 459
RPS24 Rabbit pAb
A9044-20ul 20 ul Ask for price
RPS24 Rabbit pAb
A9044-50ul 50 ul Ask for price
RPS24 Polyclonal Antibody
A60698 100 µg
EUR 570.55
Description: The best epigenetics products
anti- RPS24 antibody
FNab07466 100µg
EUR 548.75
  • Immunogen: ribosomal protein S24
  • Uniprot ID: P62847
  • Gene ID: 6229
  • Research Area: Metabolism
Description: Antibody raised against RPS24
Anti-RPS24 antibody
PAab07466 100 ug
EUR 386
Anti-RPS24 antibody
STJ111540 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia.
Anti-RPS24 antibody
STJ114017 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia.
RPS24 protein (His tag)
80R-2914 20 ug
EUR 327
Description: Purified recombinant RPS24 protein (His tag)
RPS24 ELISA KIT|Human
EF002623 96 Tests
EUR 689
Mouse RPS24 shRNA Plasmid
20-abx972516
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS24 shRNA Plasmid
20-abx986709
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS24 Antibody, HRP conjugated
1-CSB-PA020402LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS24. Recognizes RPS24 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS24 Antibody, FITC conjugated
1-CSB-PA020402LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS24. Recognizes RPS24 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS24 Antibody, Biotin conjugated
1-CSB-PA020402LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS24. Recognizes RPS24 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human RPS24 shRNA Plasmid
20-abx954192
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS24 Recombinant Protein (Human)
RP027157 100 ug Ask for price
RPS24 Recombinant Protein (Mouse)
RP169226 100 ug Ask for price
RPS24 Recombinant Protein (Mouse)
RP169229 100 ug Ask for price
RPS24 Recombinant Protein (Mouse)
RP169232 100 ug Ask for price
RPS24 Recombinant Protein (Rat)
RP226829 100 ug Ask for price
Ribosomal Protein S24 (RPS24) Antibody
20-abx218369
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S24 (RPS24) Antibody
20-abx124396
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S24 (RPS24) Antibody
20-abx126497
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S24 (RPS24) Antibody
abx146478-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ribosomal Protein S24 (RPS24) Antibody
abx237466-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ribosomal Protein S24 (RPS24) Antibody
20-abx301268
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS24 Polyclonal Antibody, Biotin Conjugated
A60699 100 µg
EUR 570.55
Description: kits suitable for this type of research
RPS24 Polyclonal Antibody, FITC Conjugated
A60700 100 µg
EUR 570.55
Description: fast delivery possible
RPS24 Polyclonal Antibody, HRP Conjugated
A60701 100 µg
EUR 570.55
Description: reagents widely cited
Rps24 ORF Vector (Rat) (pORF)
ORF075611 1.0 ug DNA
EUR 506
RPS24 ORF Vector (Human) (pORF)
ORF009053 1.0 ug DNA
EUR 95
Rps24 ORF Vector (Mouse) (pORF)
ORF056410 1.0 ug DNA
EUR 506
Rps24 ORF Vector (Mouse) (pORF)
ORF056411 1.0 ug DNA
EUR 506
Rps24 ORF Vector (Mouse) (pORF)
ORF056412 1.0 ug DNA
EUR 506
Human 40S ribosomal protein S24 (RPS24)
1-CSB-RP024544h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 40S ribosomal protein S24(RPS24),partial expressed in E.coli
40S Ribosomal Protein S24 (RPS24) Antibody
20-abx110719
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S24 (RPS24) Antibody (HRP)
20-abx305180
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S24 (RPS24) Antibody (FITC)
20-abx305181
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S24 (RPS24) Antibody (Biotin)
20-abx305182
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps24 sgRNA CRISPR Lentivector set (Rat)
K7029701 3 x 1.0 ug
EUR 339
RPS24 sgRNA CRISPR Lentivector set (Human)
K2045101 3 x 1.0 ug
EUR 339
Rps24 sgRNA CRISPR Lentivector set (Mouse)
K4705901 3 x 1.0 ug
EUR 339
Human Ribosomal Protein S24 (RPS24) ELISA Kit
abx382948-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rps24 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7029702 1.0 ug DNA
EUR 154
Rps24 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7029703 1.0 ug DNA
EUR 154
Rps24 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7029704 1.0 ug DNA
EUR 154
RPS24 sgRNA CRISPR Lentivector (Human) (Target 1)
K2045102 1.0 ug DNA
EUR 154
RPS24 sgRNA CRISPR Lentivector (Human) (Target 2)
K2045103 1.0 ug DNA
EUR 154
RPS24 sgRNA CRISPR Lentivector (Human) (Target 3)
K2045104 1.0 ug DNA
EUR 154
Rps24 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4705902 1.0 ug DNA
EUR 154
Rps24 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4705903 1.0 ug DNA
EUR 154
Rps24 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4705904 1.0 ug DNA
EUR 154
RPS24 Ribosomal Protein S24 Human Recombinant Protein
PROTP62847 Regular: 10ug
EUR 317
Description: RPS24 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 153 amino acids (1-130) and having a molecular mass of 17.5kDa.;RPS24 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
RPS24 Protein Vector (Rat) (pPB-C-His)
PV302442 500 ng
EUR 603
RPS24 Protein Vector (Rat) (pPB-N-His)
PV302443 500 ng
EUR 603
RPS24 Protein Vector (Rat) (pPM-C-HA)
PV302444 500 ng
EUR 603
RPS24 Protein Vector (Rat) (pPM-C-His)
PV302445 500 ng
EUR 603
RPS24 Protein Vector (Mouse) (pPB-C-His)
PV225638 500 ng
EUR 603
RPS24 Protein Vector (Mouse) (pPB-N-His)
PV225639 500 ng
EUR 603
RPS24 Protein Vector (Mouse) (pPM-C-HA)
PV225640 500 ng
EUR 603
RPS24 Protein Vector (Mouse) (pPM-C-His)
PV225641 500 ng
EUR 603
RPS24 Protein Vector (Mouse) (pPB-C-His)
PV225642 500 ng
EUR 603
RPS24 Protein Vector (Mouse) (pPB-N-His)
PV225643 500 ng
EUR 603
RPS24 Protein Vector (Mouse) (pPM-C-HA)
PV225644 500 ng
EUR 603
RPS24 Protein Vector (Mouse) (pPM-C-His)
PV225645 500 ng
EUR 603