Human BCHE(Butyrylcholinesterase) ELISA Kit


Human BCHE(Butyrylcholinesterase) ELISA Kit 

Order Now:

Human Butyrylcholinesterase (BCHE) ELISA Kit
EUR 673
  • Should the Human Butyrylcholinesterase (BCHE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Butyrylcholinesterase (BCHE) in samples from serum, plasma or other biological fluids.
Human Butyrylcholinesterase (BCHE) ELISA Kit
RD-BCHE-Hu-48Tests 48 Tests
EUR 521
Human Butyrylcholinesterase (BCHE) ELISA Kit
RD-BCHE-Hu-96Tests 96 Tests
EUR 723
Human Butyrylcholinesterase (BCHE) ELISA Kit
RDR-BCHE-Hu-48Tests 48 Tests
EUR 544
Human Butyrylcholinesterase (BCHE) ELISA Kit
RDR-BCHE-Hu-96Tests 96 Tests
EUR 756
Rat Butyrylcholinesterase (BCHE) ELISA Kit
EUR 549
  • Should the Rat Butyrylcholinesterase (BCHE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Butyrylcholinesterase (BCHE) in samples from serum, plasma or other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
EUR 718
  • Should the Rat Butyrylcholinesterase (BCHE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Butyrylcholinesterase (BCHE) in samples from serum, plasma or other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
RD-BCHE-Ra-48Tests 48 Tests
EUR 557
Rat Butyrylcholinesterase (BCHE) ELISA Kit
RD-BCHE-Ra-96Tests 96 Tests
EUR 775
Rat Butyrylcholinesterase (BCHE) ELISA Kit
RDR-BCHE-Ra-48Tests 48 Tests
EUR 583
Rat Butyrylcholinesterase (BCHE) ELISA Kit
RDR-BCHE-Ra-96Tests 96 Tests
EUR 811
Human Butyrylcholinesterase, BCHE ELISA KIT
ELI-33700h 96 Tests
EUR 824
Human Butyrylcholinesterase (BCHE) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Butyrylcholinesterase (BCHE)ELISA Kit
201-12-2520 96 tests
EUR 440
  • This Butyrylcholinesterase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Butyrylcholinesterase (BCHE) ELISA Kit
SEC348Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Butyrylcholinesterase (BCHE) in serum, plasma and other biological fluids.
Human Butyrylcholinesterase (BCHE) ELISA Kit
SEC348Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Butyrylcholinesterase (BCHE) in serum, plasma and other biological fluids.
Human Butyrylcholinesterase (BCHE) ELISA Kit
SEC348Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Butyrylcholinesterase (BCHE) in serum, plasma and other biological fluids.
Human Butyrylcholinesterase (BCHE) ELISA Kit
SEC348Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Butyrylcholinesterase (BCHE) in serum, plasma and other biological fluids.
Human Butyrylcholinesterase (BCHE) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Butyrylcholinesterase elisa. Alternative names of the recognized antigen: BuChE
  • CHE1
  • E1
  • Pseudocholinesterase
  • Cholinesterase
  • Acylcholine acylhydrolase
  • Butyrylcholine esterase
  • Choline esterase II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Butyrylcholinesterase (BCHE) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Butyrylcholinesterase ELISA Kit (BCHE)
RK00969 96 Tests
EUR 521
Human Butyrylcholinesterase(BCHE)ELISA Kit
QY-E03787 96T
EUR 361
Mouse Butyrylcholinesterase (BCHE) ELISA Kit
CEC348Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Butyrylcholinesterase (BCHE) ELISA Kit
CEC348Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Butyrylcholinesterase (BCHE) ELISA Kit
CEC348Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Butyrylcholinesterase (BCHE) ELISA Kit
CEC348Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Butyrylcholinesterase (BCHE) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Butyrylcholinesterase elisa. Alternative names of the recognized antigen: BuChE
  • CHE1
  • E1
  • Pseudocholinesterase
  • Cholinesterase
  • Acylcholine acylhydrolase
  • Butyrylcholine esterase
  • Choline esterase II
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Butyrylcholinesterase (BCHE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
CEC348Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
CEC348Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
CEC348Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
CEC348Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Butyrylcholinesterase elisa. Alternative names of the recognized antigen: BuChE
  • CHE1
  • E1
  • Pseudocholinesterase
  • Cholinesterase
  • Acylcholine acylhydrolase
  • Butyrylcholine esterase
  • Choline esterase II
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Butyrylcholinesterase (BCHE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Butyrylcholinesterase (BCHE) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
SEC348Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates and other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
SEC348Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates and other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
SEC348Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates and other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
SEC348Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates and other biological fluids.
Rat Butyrylcholinesterase (BCHE) ELISA Kit
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Butyrylcholinesterase elisa. Alternative names of the recognized antigen: BuChE
  • CHE1
  • E1
  • Pseudocholinesterase
  • Cholinesterase
  • Acylcholine acylhydrolase
  • Butyrylcholine esterase
  • Choline esterase II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Butyrylcholinesterase (BCHE) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Butyrylcholinesterase ELISA Kit (BCHE)
RK03523 96 Tests
EUR 521
ELISA kit for Human BCHE (Butyrylcholinesterase)
E-EL-H5566 1 plate of 96 wells
EUR 534
  • Gentaur's BCHE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human BCHE. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human BCHE (Butyrylcholinesterase) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human BCHE (Butyrylcholinesterase)
ELK3611 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Butyrylcholinesterase (BCHE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Butyr
  • Show more
Description: A sandwich ELISA kit for detection of Butyrylcholinesterase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Butyrylcholinesterase (BCHE) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Butyrylcholinesterase (BCHE) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Butyrylcholinesterase (BCHE) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Butyrylcholinesterase (BCHE) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Butyrylcholinesterase (BCHE) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Butyrylcholinesterase (BCHE) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Butyrylcholinesterase (BCHE) Antibody
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Butyrylcholinesterase (BCHE)
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P06276
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Butyrylcholinesterase expressed in: E.coli
Recombinant Butyrylcholinesterase (BCHE)
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P06276
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Butyrylcholinesterase expressed in: E.coli
Recombinant Butyrylcholinesterase (BCHE)
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JKC1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Butyrylcholinesterase expressed in: E.coli
Human Butyrylcholinesterase (BCHE) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Butyrylcholinesterase (BCHE) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Butyrylcholinesterase (BCHE) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
ELISA kit for Rat BCHE (Butyrylcholinesterase)
ELK7689 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Butyrylcholinesterase (BCHE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Butyr
  • Show more
Description: A sandwich ELISA kit for detection of Butyrylcholinesterase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Rat BCHE (Butyrylcholinesterase)
ELK7735 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Butyrylcholinesterase (BCHE) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Butyrylcholinesterase (BCHE) and unlabeled Butyrylcholinesterase (BCHE) (Standa
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Butyrylcholinesterase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse BCHE (Butyrylcholinesterase)
ELK7806 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Butyrylcholinesterase (BCHE) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Butyrylcholinesterase (BCHE) and unlabeled Butyrylcholinesterase (BCHE) (Standa
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Butyrylcholinesterase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Rat Butyrylcholinesterase (BCHE) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Butyrylcholinesterase (BCHE) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Butyrylcholinesterase (BCHE) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rat Butyrylcholinesterase (BCHE) Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Butyrylcholinesterase (BCHE) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Butyrylcholinesterase (BCHE) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Butyrylcholinesterase (BCHE) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Butyrylcholinesterase (BCHE) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Butyrylcholinesterase (BCHE) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Butyrylcholinesterase/BCHE Antibody
PB9526 100ug/vial
EUR 294
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Glu29~Thr150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE)
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Asn345~Phe570)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE)
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Glu29~Thr150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with APC.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Glu29~Thr150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with Biotin.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Glu29~Thr150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with Cy3.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Glu29~Thr150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with FITC.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Glu29~Thr150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with HRP.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Glu29~Thr150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with PE.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Glu29~Thr150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with APC-Cy7.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Asn345~Phe570)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with APC.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), Biotinylated
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Asn345~Phe570)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with Biotin.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Asn345~Phe570)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with Cy3.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Asn345~Phe570)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with FITC.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Asn345~Phe570)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with HRP.
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Asn345~Phe570)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with PE.
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-100ug
QP9007-ye-100ug 100ug
EUR 480
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-10ug
QP9007-ye-10ug 10ug
EUR 236
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-1mg
QP9007-ye-1mg 1mg
EUR 1885
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-200ug
QP9007-ye-200ug 200ug
EUR 744
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-500ug
QP9007-ye-500ug 500ug
EUR 1206
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-50ug
QP9007-ye-50ug 50ug
EUR 299
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: BCHE (Asn345~Phe570)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with APC-Cy7.
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-100ug
QP5708-ec-100ug 100ug
EUR 707
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-10ug
QP5708-ec-10ug 10ug
EUR 326
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-1mg
QP5708-ec-1mg 1mg
EUR 2303
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-200ug
QP5708-ec-200ug 200ug
EUR 1115
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-500ug
QP5708-ec-500ug 500ug
EUR 1514
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-50ug
QP5708-ec-50ug 50ug
EUR 435
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-100ug
QP5708-ye-100ug 100ug
EUR 788
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-10ug
QP5708-ye-10ug 10ug
EUR 362
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-1mg
QP5708-ye-1mg 1mg
EUR 2747
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-200ug
QP5708-ye-200ug 200ug
EUR 1260
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-500ug
QP5708-ye-500ug 500ug
EUR 1804
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-50ug
QP5708-ye-50ug 50ug
EUR 480
ELA-E8904h 96 Tests
EUR 824
EF006454 96 Tests
EUR 689
44-0120 1 kU
EUR 259
Description: Butyrylcholine Esterase enzyme
Human Cholinesterase (BCHE) ELISA Kit
abx572559-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human BCHE/ Cholinesterase ELISA Kit
E0257Hu 1 Kit
EUR 605
Human Cholinesterase(BCHE) ELISA kit
E01C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cholinesterase(BCHE) ELISA kit
E01C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cholinesterase(BCHE) ELISA kit
E01C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human BCHE PicoKine ELISA Kit
EK1507 96 wells
EUR 425
Description: For quantitative detection of human BCHE in cell culture supernates, serum, plasma (heparin, EDTA), saliva, urine and human milk.
ELISA kit for Human BCHE
EK5709 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human BCHE in samples from serum, plasma, tissue homogenates and other biological fluids.
Human BCHE(Cholinesterase) ELISA Kit
EH2406 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P06276
  • Alias: BCHE/Cholinesterase/Pseudocholinesterase/Choline esterase II/Acylcholine acylhydrolase/Butyrylcholine esterase/CHE1/Pseudocholinesterase/butyrylcholinesterase/CHE1cholinesterase/cholinesteras
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml
Human Cholinesterase (BCHE) ELISA Kit
abx251768-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Cholinesterase(BCHE) ELISA kit
CSB-EL002604HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cholinesterase (BCHE) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Cholinesterase(BCHE) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Cholinesterase(BCHE) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
BCHE ELISA Kit (Human) (OKAN06210)
OKAN06210 96 Wells
EUR 792
Description: Description of target: This gene encodes a cholinesterase enzyme and member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.115 ng/mL
BCHE ELISA Kit (Human) (OKCD08097)
OKCD08097 96 Wells
EUR 975
Description: Description of target: Mutant alleles at the BCHE locus are responsible for suxamethonium sensitivity. Homozygous persons sustain prolonged apnea after administration of the muscle relaxant suxamethonium in connection with surgical anesthesia. The activity of pseudocholinesterase in the serum is low and its substrate behavior is atypical. In the absence of the relaxant, the homozygote is at no known disadvantage.Mutant alleles at the BCHE locus are responsible for suxamethonium sensitivity. Homozygous persons sustain prolonged apnea after administration of the muscle relaxant suxamethonium in connection with surgical anesthesia. The activity of pseudocholinesterase in the serum is low and its substrate behavior is atypical. In the absence of the relaxant, the homozygote is at no known disadvantage.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.115ng/mL
BCHE ELISA Kit (Human) (OKBB01043)
OKBB01043 96 Wells
EUR 505
Description: Description of target: Butyrylcholinesterase is a nonspecific cholinesterase enzyme that in humans is encoded by the BCHE gene. This gene is mapped to 3q26. It is a member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
YF-PA23290 50 ul
EUR 334
Description: Mouse polyclonal to Butyrylcholinesterase
Butyrylcholinesterase Activity Kit (Colorimetric)
EUR 664
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Cow Cholinesterase (BCHE) ELISA Kit
abx520853-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Dog Cholinesterase (BCHE) ELISA Kit
abx520854-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Cholinesterase (BCHE) ELISA Kit
abx520856-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Pig Cholinesterase (BCHE) ELISA Kit
abx520857-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Goat Cholinesterase(BCHE) ELISA kit
E06C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cholinesterase(BCHE) ELISA kit
E06C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cholinesterase(BCHE) ELISA kit
E06C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cholinesterase(BCHE) ELISA kit
E02C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cholinesterase(BCHE) ELISA kit
E02C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cholinesterase(BCHE) ELISA kit
E02C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cholinesterase(BCHE) ELISA kit
E03C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cholinesterase(BCHE) ELISA kit
E03C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cholinesterase(BCHE) ELISA kit
E03C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cholinesterase(BCHE) ELISA kit
E04C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cholinesterase(BCHE) ELISA kit
E04C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cholinesterase(BCHE) ELISA kit
E04C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cholinesterase(BCHE) ELISA kit
E07C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cholinesterase(BCHE) ELISA kit
E07C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cholinesterase(BCHE) ELISA kit
E07C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cholinesterase(BCHE) ELISA kit
E08C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cholinesterase(BCHE) ELISA kit
E08C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cholinesterase(BCHE) ELISA kit
E08C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cholinesterase(BCHE) ELISA kit
E09C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cholinesterase(BCHE) ELISA kit
E09C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cholinesterase(BCHE) ELISA kit
E09C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cholinesterase, BCHE ELISA KIT
ELI-10644Ra 96 Tests
EUR 928
Bovine Cholinesterase, BCHE ELISA KIT
ELI-25278b 96 Tests
EUR 928
Canine Cholinesterase, BCHE ELISA KIT
ELI-33699d 96 Tests
EUR 928
Porcine Cholinesterase, BCHE ELISA KIT
ELI-33907p 96 Tests
EUR 928
Mouse Cholinesterase, Bche ELISA KIT
ELI-50081m 96 Tests
EUR 865
Rat Cholinesterase (BCHE) ELISA Kit
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Pig BCHE/ Cholinesterase ELISA Kit
E0022Pi 1 Kit
EUR 717
Bovine BCHE/ Cholinesterase ELISA Kit
E0035Bo 1 Kit
EUR 717
Mouse Bche/ Cholinesterase ELISA Kit
E0165Mo 1 Kit
EUR 632
BCHE ELISA Kit (Rat) (OKCD00683)
OKCD00683 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL
BCHE ELISA Kit (Mouse) (OKEH05016)
OKEH05016 96 Wells
EUR 779
Description: Description of target: Esterase with broad substrate specificity. Contributes to the inactivation of the neurotransmitter acetylcholine. Can degrade neurotoxic organophosphate esters.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL
BCHE ELISA Kit (Bovine) (OKEH08709)
OKEH08709 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.9pg/ml
BCHE ELISA Kit (Dog) (OKEH08710)
OKEH08710 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
BCHE ELISA Kit (Pig) (OKEH08711)
OKEH08711 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 25pg/mL
Human Cholinesterase (BCHE)
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cholinesterase(BCHE) expressed in Yeast
BCHE ELISA Kit (Human) : 96 Wells (OKEH01874)
OKEH01874 96 Wells
EUR 779
Description: Description of target: Mutant alleles at the BCHE locus are responsible for suxamethonium sensitivity. Homozygous persons sustain prolonged apnea after administration of the muscle relaxant suxamethonium in connection with surgical anesthesia. The activity of pseudocholinesterase in the serum is low and its substrate behavior is atypical. In the absence of the relaxant, the homozygote is at no known disadvantage;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL
Bche ELISA Kit| Mouse Cholinesterase ELISA Kit
EF014352 96 Tests
EUR 689
BCHE ELISA Kit| Bovine Cholinesterase ELISA Kit
EF011177 96 Tests
EUR 689
Butyrylcholinesterase Standard, 225UL
C051-225UL 225UL
EUR 123
Native Equine Butyrylcholinesterase
NATE-0092 500 u
EUR 270
Guinea pig Cholinesterase(BCHE) ELISA kit
E05C1216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Cholinesterase(BCHE) ELISA kit
E05C1216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Cholinesterase(BCHE) ELISA kit
E05C1216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
BCHE Antibody
ABD6419 100 ug
EUR 438
BCHE Antibody
46340-100ul 100ul
EUR 252
BChE antibody
10-1810 200 ul
EUR 565
Description: Mouse monoclonal BChE antibody
BCHE Antibody
32284-100ul 100ul
EUR 252
BCHE antibody
10R-3422 100 ul
EUR 691
Description: Mouse monoclonal BCHE antibody
BCHE antibody
10R-3423 100 ul
EUR 726
Description: Mouse monoclonal BCHE antibody
BCHE antibody
70R-1889 100 ug
EUR 377
Description: Rabbit polyclonal BCHE antibody raised against the N terminal of BCHE
BCHE Antibody
DF6419 200ul
EUR 304
Description: BCHE Antibody detects endogenous levels of total BCHE.
BCHE Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BCHE. Recognizes BCHE from Dog. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
BCHE Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BCHE. Recognizes BCHE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200
Human BCHE shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
BCHE Recombinant Protein (Human)
RP002911 100 ug Ask for price
BCHE Recombinant Protein (Human)
RP002914 100 ug Ask for price
Butyrylcholinesterase Fluorescent Activity kit (2 plate)
K016-F1 2x96 well plates
EUR 344
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Rat Cholinesterase (BCHE) CLIA Kit
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
BChE Substrate, 1EA
C052-1EA 1EA
EUR 143
BCHE Conjugated Antibody
C32284 100ul
EUR 397
BCHE cloning plasmid
CSB-CL002604HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 195
  • Sequence: atgacgaaactacgtgctcaacaatgtcgattctggacatcattttttccaaaagtcttggaaatgacaggaaatattgatgaagcagaatgggagtggaaagcaggattccatcgctggaacaattacatgatggactggaaaaatcaatttaacgattacactagcaagaaaga
  • Show more
Description: A cloning plasmid for the BCHE gene.
BCHE cloning plasmid
CSB-CL002604HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1809
  • Sequence: atgcatagcaaagtcacaatcatatgcatcagatttctcttttggtttcttttgctctgcatgcttattgggaagtcacatactgaagatgacatcataattgcaacaaagaatggaaaagtcagagggatgaacttgacagtttttggtggcacggtaacagcctttcttggaa
  • Show more
Description: A cloning plasmid for the BCHE gene.
anti- BCHE antibody
FNab00833 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: butyrylcholinesterase
  • Uniprot ID: P06276
  • Gene ID: 590
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against BCHE
Cholinesterase (BCHE) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cholinesterase (BCHE) Antibody
abx033707-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Cholinesterase (BCHE) Antibody
abx033707-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Cholinesterase (BCHE) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cholinesterase (BCHE) Antibody
abx230833-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
BCHE Polyclonal Antibody
A53245 100 µg
EUR 570.55
Description: kits suitable for this type of research
BCHE Rabbit pAb
A1460-100ul 100 ul
EUR 308
BCHE Rabbit pAb
A1460-200ul 200 ul
EUR 459
BCHE Rabbit pAb
A1460-20ul 20 ul
EUR 183