- Home
- Human BCHE(Butyrylcholinesterase) ELISA Kit
Human BCHE(Butyrylcholinesterase) ELISA Kit
Order Now: lieven@gentaur.com
Human Butyrylcholinesterase (BCHE) ELISA Kit |
DLR-BCHE-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Butyrylcholinesterase (BCHE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Butyrylcholinesterase (BCHE) in samples from serum, plasma or other biological fluids. |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
RD-BCHE-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
RD-BCHE-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
RDR-BCHE-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
RDR-BCHE-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
DLR-BCHE-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Butyrylcholinesterase (BCHE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Butyrylcholinesterase (BCHE) in samples from serum, plasma or other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
DLR-BCHE-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Butyrylcholinesterase (BCHE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Butyrylcholinesterase (BCHE) in samples from serum, plasma or other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
RD-BCHE-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
RD-BCHE-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
RDR-BCHE-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
RDR-BCHE-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Butyrylcholinesterase, BCHE ELISA KIT |
ELI-33700h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
20-abx150847 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Butyrylcholinesterase (BCHE)ELISA Kit |
201-12-2520 |
SunredBio |
96 tests |
EUR 440 |
- This Butyrylcholinesterase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
SEC348Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Butyrylcholinesterase (BCHE) in serum, plasma and other biological fluids. |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
SEC348Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Butyrylcholinesterase (BCHE) in serum, plasma and other biological fluids. |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
SEC348Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Butyrylcholinesterase (BCHE) in serum, plasma and other biological fluids. |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
SEC348Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Butyrylcholinesterase (BCHE) in serum, plasma and other biological fluids. |
Human Butyrylcholinesterase (BCHE) ELISA Kit |
4-SEC348Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Butyrylcholinesterase elisa. Alternative names of the recognized antigen: BuChE
- CHE1
- E1
- Pseudocholinesterase
- Cholinesterase
- Acylcholine acylhydrolase
- Butyrylcholine esterase
- Choline esterase II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Butyrylcholinesterase (BCHE) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Butyrylcholinesterase ELISA Kit (BCHE) |
RK00969 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Butyrylcholinesterase (BCHE) ELISA Kit |
CEC348Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Butyrylcholinesterase (BCHE) ELISA Kit |
CEC348Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Butyrylcholinesterase (BCHE) ELISA Kit |
CEC348Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Butyrylcholinesterase (BCHE) ELISA Kit |
CEC348Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Butyrylcholinesterase (BCHE) ELISA Kit |
4-CEC348Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Butyrylcholinesterase elisa. Alternative names of the recognized antigen: BuChE
- CHE1
- E1
- Pseudocholinesterase
- Cholinesterase
- Acylcholine acylhydrolase
- Butyrylcholine esterase
- Choline esterase II
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Butyrylcholinesterase (BCHE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
CEC348Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4875.49 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
CEC348Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 489.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
CEC348Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 655.94 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
CEC348Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2651.73 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
4-CEC348Ra |
Cloud-Clone |
-
EUR 4926.00
-
EUR 2602.00
-
EUR 656.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Butyrylcholinesterase elisa. Alternative names of the recognized antigen: BuChE
- CHE1
- E1
- Pseudocholinesterase
- Cholinesterase
- Acylcholine acylhydrolase
- Butyrylcholine esterase
- Choline esterase II
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Butyrylcholinesterase (BCHE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
20-abx155274 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Butyrylcholinesterase (BCHE) ELISA Kit |
20-abx258796 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
SEC348Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
SEC348Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
SEC348Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
SEC348Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Butyrylcholinesterase (BCHE) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Butyrylcholinesterase (BCHE) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) ELISA Kit |
4-SEC348Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Butyrylcholinesterase elisa. Alternative names of the recognized antigen: BuChE
- CHE1
- E1
- Pseudocholinesterase
- Cholinesterase
- Acylcholine acylhydrolase
- Butyrylcholine esterase
- Choline esterase II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Butyrylcholinesterase (BCHE) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Butyrylcholinesterase ELISA Kit (BCHE) |
RK03523 |
Abclonal |
96 Tests |
EUR 521 |
ELISA kit for Human BCHE (Butyrylcholinesterase) |
E-EL-H5566 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's BCHE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human BCHE. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human BCHE (Butyrylcholinesterase) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human BCHE (Butyrylcholinesterase) |
ELK3611 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Butyrylcholinesterase (BCHE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Butyr
- Show more
|
Description: A sandwich ELISA kit for detection of Butyrylcholinesterase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Butyrylcholinesterase (BCHE) Antibody |
20-abx130735 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Butyrylcholinesterase (BCHE) Antibody |
20-abx110531 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Butyrylcholinesterase (BCHE) Antibody |
20-abx102099 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Butyrylcholinesterase (BCHE) Antibody |
20-abx175633 |
Abbexa |
|
|
|
Butyrylcholinesterase (BCHE) Antibody |
20-abx338390 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Butyrylcholinesterase (BCHE) Antibody |
20-abx171485 |
Abbexa |
|
|
|
Butyrylcholinesterase (BCHE) Antibody |
20-abx171486 |
Abbexa |
|
|
|
Recombinant Butyrylcholinesterase (BCHE) |
4-RPC348Hu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P06276
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 14.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Butyrylcholinesterase expressed in: E.coli |
Recombinant Butyrylcholinesterase (BCHE) |
4-RPC348Hu02 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P06276
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Butyrylcholinesterase expressed in: E.coli |
Recombinant Butyrylcholinesterase (BCHE) |
4-RPC348Ra01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9JKC1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Butyrylcholinesterase expressed in: E.coli |
Human Butyrylcholinesterase (BCHE) CLIA Kit |
20-abx493633 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Butyrylcholinesterase (BCHE) Protein |
20-abx652190 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Butyrylcholinesterase (BCHE) Protein |
20-abx065611 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Rat BCHE (Butyrylcholinesterase) |
ELK7689 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Butyrylcholinesterase (BCHE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Butyr
- Show more
|
Description: A sandwich ELISA kit for detection of Butyrylcholinesterase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Rat BCHE (Butyrylcholinesterase) |
ELK7735 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Butyrylcholinesterase (BCHE) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Butyrylcholinesterase (BCHE) and unlabeled Butyrylcholinesterase (BCHE) (Standa
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Butyrylcholinesterase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse BCHE (Butyrylcholinesterase) |
ELK7806 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Butyrylcholinesterase (BCHE) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Butyrylcholinesterase (BCHE) and unlabeled Butyrylcholinesterase (BCHE) (Standa
- Show more
|
Description: A competitive Inhibition ELISA kit for detection of Butyrylcholinesterase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat Butyrylcholinesterase (BCHE) CLIA Kit |
20-abx490462 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Butyrylcholinesterase (BCHE) CLIA Kit |
20-abx490594 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Butyrylcholinesterase (BCHE) Antibody (HRP) |
20-abx109082 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rat Butyrylcholinesterase (BCHE) Protein |
20-abx168910 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Butyrylcholinesterase (BCHE) Antibody (Biotin) |
20-abx106251 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Butyrylcholinesterase (BCHE) Antibody (FITC) |
20-abx107665 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Butyrylcholinesterase (BCHE) Antibody (HRP) |
20-abx335103 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Butyrylcholinesterase (BCHE) Antibody (FITC) |
20-abx335104 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Butyrylcholinesterase (BCHE) Antibody (Biotin) |
20-abx335105 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Butyrylcholinesterase/BCHE Antibody |
PB9526 |
BosterBio |
100ug/vial |
EUR 294 |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human) |
4-PAC348Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Glu29~Thr150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE) |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat) |
4-PAC348Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Asn345~Phe570)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE) |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), APC |
4-PAC348Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Glu29~Thr150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with APC. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), Biotinylated |
4-PAC348Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Glu29~Thr150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with Biotin. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), Cy3 |
4-PAC348Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Glu29~Thr150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with Cy3. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), FITC |
4-PAC348Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Glu29~Thr150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with FITC. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), HRP |
4-PAC348Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Glu29~Thr150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with HRP. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), PE |
4-PAC348Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Glu29~Thr150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with PE. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC348Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Glu29~Thr150)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Butyrylcholinesterase (BCHE). This antibody is labeled with APC-Cy7. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), APC |
4-PAC348Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Asn345~Phe570)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with APC. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), Biotinylated |
4-PAC348Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Asn345~Phe570)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with Biotin. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), Cy3 |
4-PAC348Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Asn345~Phe570)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with Cy3. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), FITC |
4-PAC348Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Asn345~Phe570)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with FITC. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), HRP |
4-PAC348Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Asn345~Phe570)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with HRP. |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), PE |
4-PAC348Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Asn345~Phe570)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with PE. |
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-100ug |
QP9007-ye-100ug |
EnQuireBio |
100ug |
EUR 480 |
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-10ug |
QP9007-ye-10ug |
EnQuireBio |
10ug |
EUR 236 |
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-1mg |
QP9007-ye-1mg |
EnQuireBio |
1mg |
EUR 1885 |
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-200ug |
QP9007-ye-200ug |
EnQuireBio |
200ug |
EUR 744 |
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-500ug |
QP9007-ye-500ug |
EnQuireBio |
500ug |
EUR 1206 |
Recombinant Human BCHE/ Butyrylcholinesterase Protein, His, Yeast-50ug |
QP9007-ye-50ug |
EnQuireBio |
50ug |
EUR 299 |
Butyrylcholinesterase (BCHE) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC348Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BCHE (Asn345~Phe570)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Butyrylcholinesterase (BCHE). This antibody is labeled with APC-Cy7. |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-100ug |
QP5708-ec-100ug |
EnQuireBio |
100ug |
EUR 707 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-10ug |
QP5708-ec-10ug |
EnQuireBio |
10ug |
EUR 326 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-1mg |
QP5708-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-200ug |
QP5708-ec-200ug |
EnQuireBio |
200ug |
EUR 1115 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-500ug |
QP5708-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, E.coli-50ug |
QP5708-ec-50ug |
EnQuireBio |
50ug |
EUR 435 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-100ug |
QP5708-ye-100ug |
EnQuireBio |
100ug |
EUR 788 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-10ug |
QP5708-ye-10ug |
EnQuireBio |
10ug |
EUR 362 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-1mg |
QP5708-ye-1mg |
EnQuireBio |
1mg |
EUR 2747 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-200ug |
QP5708-ye-200ug |
EnQuireBio |
200ug |
EUR 1260 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-500ug |
QP5708-ye-500ug |
EnQuireBio |
500ug |
EUR 1804 |
Recombinant Dog BCHE/ Butyrylcholinesterase Protein, His, Yeast-50ug |
QP5708-ye-50ug |
EnQuireBio |
50ug |
EUR 480 |
Butyrylcholinesterase |
44-0120 |
Fitzgerald |
1 kU |
EUR 259 |
Description: Butyrylcholine Esterase enzyme |
Human Cholinesterase (BCHE) ELISA Kit |
abx572559-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human BCHE/ Cholinesterase ELISA Kit |
E0257Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Cholinesterase(BCHE) ELISA kit |
E01C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cholinesterase(BCHE) ELISA kit |
E01C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cholinesterase(BCHE) ELISA kit |
E01C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human BCHE PicoKine ELISA Kit |
EK1507 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human BCHE in cell culture supernates, serum, plasma (heparin, EDTA), saliva, urine and human milk. |
ELISA kit for Human BCHE |
EK5709 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human BCHE in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human BCHE(Cholinesterase) ELISA Kit |
EH2406 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: P06276
- Alias: BCHE/Cholinesterase/Pseudocholinesterase/Choline esterase II/Acylcholine acylhydrolase/Butyrylcholine esterase/CHE1/Pseudocholinesterase/butyrylcholinesterase/CHE1cholinesterase/cholinesteras
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human Cholinesterase (BCHE) ELISA Kit |
abx251768-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Cholinesterase(BCHE) ELISA kit |
CSB-EL002604HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Cholinesterase (BCHE) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Cholinesterase(BCHE) ELISA kit |
1-CSB-EL002604HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Cholinesterase(BCHE) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
BCHE ELISA Kit (Human) (OKAN06210) |
OKAN06210 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a cholinesterase enzyme and member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.115 ng/mL |
BCHE ELISA Kit (Human) (OKCD08097) |
OKCD08097 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Mutant alleles at the BCHE locus are responsible for suxamethonium sensitivity. Homozygous persons sustain prolonged apnea after administration of the muscle relaxant suxamethonium in connection with surgical anesthesia. The activity of pseudocholinesterase in the serum is low and its substrate behavior is atypical. In the absence of the relaxant, the homozygote is at no known disadvantage.Mutant alleles at the BCHE locus are responsible for suxamethonium sensitivity. Homozygous persons sustain prolonged apnea after administration of the muscle relaxant suxamethonium in connection with surgical anesthesia. The activity of pseudocholinesterase in the serum is low and its substrate behavior is atypical. In the absence of the relaxant, the homozygote is at no known disadvantage.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.115ng/mL |
BCHE ELISA Kit (Human) (OKBB01043) |
OKBB01043 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Butyrylcholinesterase is a nonspecific cholinesterase enzyme that in humans is encoded by the BCHE gene. This gene is mapped to 3q26. It is a member of the type-B carboxylesterase/lipase family of proteins. The encoded enzyme exhibits broad substrate specificity and is involved in the detoxification of poisons including organophosphate nerve agents and pesticides, and the metabolism of drugs including cocaine, heroin and aspirin. Humans homozygous for certain mutations in this gene exhibit prolonged apnea after administration of the muscle relaxant succinylcholine.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
anti-Butyrylcholinesterase |
YF-PA23290 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Butyrylcholinesterase |
Butyrylcholinesterase Activity Kit (Colorimetric) |
K516-100 |
Biovision |
|
EUR 664 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Cow Cholinesterase (BCHE) ELISA Kit |
abx520853-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Dog Cholinesterase (BCHE) ELISA Kit |
abx520854-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Cholinesterase (BCHE) ELISA Kit |
abx520856-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Pig Cholinesterase (BCHE) ELISA Kit |
abx520857-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Goat Cholinesterase(BCHE) ELISA kit |
E06C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cholinesterase(BCHE) ELISA kit |
E06C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cholinesterase(BCHE) ELISA kit |
E06C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cholinesterase(BCHE) ELISA kit |
E02C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cholinesterase(BCHE) ELISA kit |
E02C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cholinesterase(BCHE) ELISA kit |
E02C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cholinesterase(BCHE) ELISA kit |
E03C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cholinesterase(BCHE) ELISA kit |
E03C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cholinesterase(BCHE) ELISA kit |
E03C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cholinesterase(BCHE) ELISA kit |
E04C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cholinesterase(BCHE) ELISA kit |
E04C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cholinesterase(BCHE) ELISA kit |
E04C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cholinesterase(BCHE) ELISA kit |
E07C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cholinesterase(BCHE) ELISA kit |
E07C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cholinesterase(BCHE) ELISA kit |
E07C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cholinesterase(BCHE) ELISA kit |
E08C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cholinesterase(BCHE) ELISA kit |
E08C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cholinesterase(BCHE) ELISA kit |
E08C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cholinesterase(BCHE) ELISA kit |
E09C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cholinesterase(BCHE) ELISA kit |
E09C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cholinesterase(BCHE) ELISA kit |
E09C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cholinesterase (BCHE) ELISA Kit |
20-abx258525 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Pig BCHE/ Cholinesterase ELISA Kit |
E0022Pi |
Sunlong |
1 Kit |
EUR 717 |
Bovine BCHE/ Cholinesterase ELISA Kit |
E0035Bo |
Sunlong |
1 Kit |
EUR 717 |
Mouse Bche/ Cholinesterase ELISA Kit |
E0165Mo |
Sunlong |
1 Kit |
EUR 632 |
BCHE ELISA Kit (Rat) (OKCD00683) |
OKCD00683 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL |
BCHE ELISA Kit (Mouse) (OKEH05016) |
OKEH05016 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Esterase with broad substrate specificity. Contributes to the inactivation of the neurotransmitter acetylcholine. Can degrade neurotoxic organophosphate esters.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL |
BCHE ELISA Kit (Bovine) (OKEH08709) |
OKEH08709 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.9pg/ml |
BCHE ELISA Kit (Dog) (OKEH08710) |
OKEH08710 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
BCHE ELISA Kit (Pig) (OKEH08711) |
OKEH08711 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 25pg/mL |
Human Cholinesterase (BCHE) |
1-CSB-YP002604HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 67.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Cholinesterase(BCHE) expressed in Yeast |
BCHE ELISA Kit (Human) : 96 Wells (OKEH01874) |
OKEH01874 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Mutant alleles at the BCHE locus are responsible for suxamethonium sensitivity. Homozygous persons sustain prolonged apnea after administration of the muscle relaxant suxamethonium in connection with surgical anesthesia. The activity of pseudocholinesterase in the serum is low and its substrate behavior is atypical. In the absence of the relaxant, the homozygote is at no known disadvantage;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
Bche ELISA Kit| Mouse Cholinesterase ELISA Kit |
EF014352 |
Lifescience Market |
96 Tests |
EUR 689 |
BCHE ELISA Kit| Bovine Cholinesterase ELISA Kit |
EF011177 |
Lifescience Market |
96 Tests |
EUR 689 |
Butyrylcholinesterase Standard, 225UL |
C051-225UL |
Arbor Assays |
225UL |
EUR 123 |
Guinea pig Cholinesterase(BCHE) ELISA kit |
E05C1216-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Cholinesterase(BCHE) ELISA kit |
E05C1216-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Cholinesterase(BCHE) ELISA kit |
E05C1216-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cholinesterase(BCHE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
BCHE siRNA |
20-abx908957 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BCHE siRNA |
20-abx908958 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BCHE Antibody |
46340-100ul |
SAB |
100ul |
EUR 252 |
BChE antibody |
10-1810 |
Fitzgerald |
200 ul |
EUR 565 |
Description: Mouse monoclonal BChE antibody |
BCHE Antibody |
32284-100ul |
SAB |
100ul |
EUR 252 |
BCHE antibody |
10R-3422 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal BCHE antibody |
BCHE antibody |
10R-3423 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal BCHE antibody |
BCHE antibody |
70R-1889 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal BCHE antibody raised against the N terminal of BCHE |
BCHE Antibody |
DF6419 |
Affbiotech |
200ul |
EUR 304 |
Description: BCHE Antibody detects endogenous levels of total BCHE. |
BCHE Antibody |
1-CSB-PA002604LA01DO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BCHE. Recognizes BCHE from Dog. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
BCHE Antibody |
1-CSB-PA002604LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BCHE. Recognizes BCHE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
Human BCHE shRNA Plasmid |
20-abx950405 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BCHE Recombinant Protein (Human) |
RP002911 |
ABM |
100 ug |
Ask for price |
BCHE Recombinant Protein (Human) |
RP002914 |
ABM |
100 ug |
Ask for price |
Butyrylcholinesterase Fluorescent Activity kit (2 plate) |
K016-F1 |
Arbor Assays |
2x96 well plates |
EUR 344 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Rat Cholinesterase (BCHE) CLIA Kit |
20-abx493634 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
BCHE Conjugated Antibody |
C32284 |
SAB |
100ul |
EUR 397 |
BCHE cloning plasmid |
CSB-CL002604HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 195
- Sequence: atgacgaaactacgtgctcaacaatgtcgattctggacatcattttttccaaaagtcttggaaatgacaggaaatattgatgaagcagaatgggagtggaaagcaggattccatcgctggaacaattacatgatggactggaaaaatcaatttaacgattacactagcaagaaaga
- Show more
|
Description: A cloning plasmid for the BCHE gene. |
BCHE cloning plasmid |
CSB-CL002604HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1809
- Sequence: atgcatagcaaagtcacaatcatatgcatcagatttctcttttggtttcttttgctctgcatgcttattgggaagtcacatactgaagatgacatcataattgcaacaaagaatggaaaagtcagagggatgaacttgacagtttttggtggcacggtaacagcctttcttggaa
- Show more
|
Description: A cloning plasmid for the BCHE gene. |
anti- BCHE antibody |
FNab00833 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: butyrylcholinesterase
- Uniprot ID: P06276
- Gene ID: 590
- Research Area: Neuroscience, Metabolism
|
Description: Antibody raised against BCHE |
Cholinesterase (BCHE) Antibody |
20-abx001249 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cholinesterase (BCHE) Antibody |
abx033707-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Cholinesterase (BCHE) Antibody |
abx033707-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Cholinesterase (BCHE) Antibody |
20-abx225059 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Cholinesterase (BCHE) Antibody |
abx230833-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
BCHE Polyclonal Antibody |
A53245 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
BCHE Rabbit pAb |
A1460-100ul |
Abclonal |
100 ul |
EUR 308 |
BCHE Rabbit pAb |
A1460-200ul |
Abclonal |
200 ul |
EUR 459 |
BCHE Rabbit pAb |
A1460-20ul |
Abclonal |
20 ul |
EUR 183 |