EIF3E (EIF3E) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF3E (EIF3E) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF3E (EIF3E) Antibody

abx145188-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

EIF3E (eIF3E) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF3E (EIF3E) Antibody

abx030996-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

EIF3E (EIF3E) Antibody

abx030996-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EIF3E (EIF3E) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

EIF3E (EIF3E) Antibody

abx432644-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

EIF3E (EIF3E) Antibody

abx232706-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

EIF3E (EIF3E) Antibody

abx232707-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Eif3e/ Rat Eif3e ELISA Kit

ELI-26100r 96 Tests
EUR 886

EIF3E antibody

70R-17048 50 ul
EUR 435
Description: Rabbit polyclonal EIF3E antibody

EIF3E antibody

38657-100ul 100ul
EUR 252

EIF3E Antibody

DF8450 200ul
EUR 304
Description: EIF3E Antibody detects endogenous levels of total EIF3E.

EIF3E antibody

70R-3591 50 ug
EUR 467
Description: Rabbit polyclonal EIF3E antibody raised against the N terminal of EIF3E

EIF3E antibody

70R-3592 50 ug
EUR 467
Description: Rabbit polyclonal EIF3E antibody raised against the middle region of EIF3E

EIF3E Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3E. Recognizes EIF3E from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF3E Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3E. Recognizes EIF3E from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3E Antibody

ABD8450 100 ug
EUR 438


PVT18706 2 ug
EUR 231


YF-PA24003 50 ul
EUR 334
Description: Mouse polyclonal to eIF3e

EIF3E Blocking Peptide

33R-2557 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF3E antibody, catalog no. 70R-3591

EIF3E Blocking Peptide

33R-5232 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF3E antibody, catalog no. 70R-3592

EIF3E Blocking Peptide

DF8450-BP 1mg
EUR 195

Anti-EIF3E Antibody

A00481 100ug/200ul
EUR 397
Description: Goat Polyclonal EIF3E Antibody. Validated in WB and tested in Human.

Anti-EIF3e Antibody

A00481-1 100ug/vial
EUR 294

EIF3E Conjugated Antibody

C38657 100ul
EUR 397

EIF3E cloning plasmid

CSB-CL007534HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atggcggagtacgacttgactactcgcatcgcgcactttttggatcggcatctagtctttccgcttcttgaatttctctctgtaaaggagatatataatgaaaaggaattattacaaggtaaattggaccttcttagtgataccaacatggtagactttgctatggatgtataca
  • Show more
Description: A cloning plasmid for the EIF3E gene.

EIF3E cloning plasmid

CSB-CL007534HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atggcggagtacgacttgactactcgcatcgcgcactttttggatcggcatctagtctttccgcttcttgaatttctctctgtaaaggagatatataatgaaaaggaattattacaaggtaaattggaccttcttagtgataccaacatggtagactttgctatggatgtataca
  • Show more
Description: A cloning plasmid for the EIF3E gene.

EIF3E cloning plasmid

CSB-CL007534HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1191
  • Sequence: atggtagactttgctatggatgtatacaaaaacctttattctgatgatattcctcatgctttgagagagaaaagaaccacagtggttgcacaactgaaacagcttcaggcagaaacagaaccaattgtgaagatgtttgaagatccagaaactacaaggcaaatgcagtcaacca
  • Show more
Description: A cloning plasmid for the EIF3E gene.

EIF3E cloning plasmid

CSB-CL007534HU4-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1337
  • Sequence: atggcggagtacgacttgactactcgcatcgcgcactttttggatcggcatctagtctttccgcttcttgaatttctctctgtaaaggagatatataatgaaaaggaattattacaaggtaaattggaccttcttagtgataccaacatggtagactttgctatggatgtataca
  • Show more
Description: A cloning plasmid for the EIF3E gene.

EIF3E Rabbit pAb

A6348-100ul 100 ul
EUR 308

EIF3E Rabbit pAb

A6348-200ul 200 ul
EUR 459

EIF3E Rabbit pAb

A6348-20ul 20 ul Ask for price

EIF3E Rabbit pAb

A6348-50ul 50 ul Ask for price

EIF3E Rabbit pAb

A5447-100ul 100 ul
EUR 308

EIF3E Rabbit pAb

A5447-200ul 200 ul
EUR 459

EIF3E Rabbit pAb

A5447-20ul 20 ul
EUR 183

EIF3E Rabbit pAb

A5447-50ul 50 ul
EUR 223

anti- EIF3E antibody

FNab02706 100µg
EUR 548.75
  • Immunogen: eukaryotic translation initiation factor 3, subunit E
  • Uniprot ID: P60228
  • Gene ID: 3646
  • Research Area: Metabolism
Description: Antibody raised against EIF3E

anti- EIF3E antibody

FNab02707 100µg
EUR 505.25
  • Immunogen: eukaryotic translation initiation factor 3, subunit E
  • Uniprot ID: P60228
  • Gene ID: 3646
  • Research Area: Metabolism
Description: Antibody raised against EIF3E

Anti-EIF3E antibody

PAab02706 100 ug
EUR 386

Anti-EIF3E antibody

PAab02707 100 ug
EUR 355

Anti-EIF3E antibody

STJ27400 100 µl
EUR 277

Anti-EIF3E antibody

STJ28431 100 µl
EUR 277

Anti-EIF3E antibody

STJ72427 100 µg
EUR 359


ELI-26583h 96 Tests
EUR 824


EF009341 96 Tests
EUR 689

Rat EIF3E shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF3E shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3E shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-48144b 96 Tests
EUR 928


ELI-47289c 96 Tests
EUR 928

Mouse Eif3e ELISA KIT

ELI-47585m 96 Tests
EUR 865

EIF3E Recombinant Protein (Human)

RP010399 100 ug Ask for price

EIF3E Recombinant Protein (Human)

RP010402 100 ug Ask for price

EIF3E Recombinant Protein (Human)

RP010405 100 ug Ask for price

EIF3E Recombinant Protein (Rat)

RP199352 100 ug Ask for price

EIF3E Recombinant Protein (Mouse)

RP131279 100 ug Ask for price

Eif3e ORF Vector (Rat) (pORF)

ORF066452 1.0 ug DNA
EUR 506

EIF3E ORF Vector (Human) (pORF)

ORF003467 1.0 ug DNA
EUR 95

EIF3E ORF Vector (Human) (pORF)

ORF003468 1.0 ug DNA
EUR 95

EIF3E ORF Vector (Human) (pORF)

ORF003469 1.0 ug DNA
EUR 95

Eif3e ORF Vector (Mouse) (pORF)

ORF043761 1.0 ug DNA
EUR 506

EIF3E sgRNA CRISPR Lentivector set (Human)

K0667501 3 x 1.0 ug
EUR 339

Eif3e sgRNA CRISPR Lentivector set (Mouse)

K4685201 3 x 1.0 ug
EUR 339

Eif3e sgRNA CRISPR Lentivector set (Rat)

K6286901 3 x 1.0 ug
EUR 339