VDAC2

VDAC2 antibody
70R-21248 50 ul
EUR 435
Description: Rabbit polyclonal VDAC2 antibody
VDAC2 Antibody
47453-100ul 100ul
EUR 252
VDAC2 Antibody
1-CSB-PA025824GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
VDAC2 Antibody
1-CSB-PA025824LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
VDAC2 antibody
70R-5052 50 ug
EUR 467
Description: Rabbit polyclonal VDAC2 antibody raised against the N terminal of VDAC2
VDAC2 antibody
70R-5053 50 ug
EUR 467
Description: Rabbit polyclonal VDAC2 antibody raised against the N terminal of VDAC2
VDAC2 Antibody
AF5397 200ul
EUR 304
Description: VDAC2 antibody detects endogenous levels of total VDAC2.
VDAC2 siRNA
20-abx906016
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VDAC2 siRNA
20-abx939380
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VDAC2 siRNA
20-abx939381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VDAC2 antibody
ABF5397 100 ug
EUR 438
VDAC2 Blocking Peptide
33R-5772 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC2 antibody, catalog no. 70R-5053
VDAC2 Blocking Peptide
33R-9629 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC2 antibody, catalog no. 70R-5052
VDAC2 Blocking Peptide
AF5397-BP 1mg
EUR 195
VDAC2 Conjugated Antibody
C47453 100ul
EUR 397
VDAC2 cloning plasmid
CSB-CL025824HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atgtgtattcctccatcatatgctgaccttggcaaagctgccagagatattttcaacaaaggatttggttttgggttggtgaaactggatgtgaaaacaaagtcttgcagtggcgtggaattttcaacgtccggttcatctaatacagacactggtaaagttactgggaccttgga
  • Show more
Description: A cloning plasmid for the VDAC2 gene.
VDAC2 cloning plasmid
CSB-CL025824HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 885
  • Sequence: atggcgacccacggacagacttgcgcgcgtccaatgtgtattcctccatcatatgctgaccttggcaaagctgccagagatattttcaacaaaggatttggttttgggttggtgaaactggatgtgaaaacaaagtcttgcagtggcgtggaattttcaacgtccggttcatctaa
  • Show more
Description: A cloning plasmid for the VDAC2 gene.
anti- VDAC2 antibody
FNab09386 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: voltage-dependent anion channel 2
  • Uniprot ID: P45880
  • Gene ID: 7417
  • Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC2
anti- VDAC2 antibody
FNab09387 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: voltage-dependent anion channel 2
  • Uniprot ID: P45880
  • Gene ID: 7417
  • Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC2
Anti-VDAC2 antibody
PAab09386 100 ug
EUR 386
pCMV-SPORT6-VDAC2
PVT13664 2 ug
EUR 391
Anti-VDAC2 (3D2)
YF-MA16052 100 ug
EUR 363
Description: Mouse monoclonal to VDAC2
VDAC2 Antibody, HRP conjugated
1-CSB-PA025824LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
VDAC2 Antibody, FITC conjugated
1-CSB-PA025824LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
VDAC2 Antibody, Biotin conjugated
1-CSB-PA025824LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VDAC2. Recognizes VDAC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
VDAC2 ELISA KIT|Human
EF004186 96 Tests
EUR 689
Mouse Vdac2 ELISA KIT
ELI-51179m 96 Tests
EUR 865
Human VDAC2 ELISA KIT
ELI-44613h 96 Tests
EUR 824
Mouse VDAC2 shRNA Plasmid
20-abx973356
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat VDAC2 shRNA Plasmid
20-abx986790
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human VDAC2 shRNA Plasmid
20-abx955075
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Bovine VDAC2 ELISA KIT
ELI-39848b 96 Tests
EUR 928
VDAC2 Recombinant Protein (Rat)
RP236339 100 ug Ask for price
VDAC2 Recombinant Protein (Human)
RP034294 100 ug Ask for price
VDAC2 Recombinant Protein (Human)
RP034297 100 ug Ask for price
VDAC2 Recombinant Protein (Mouse)
RP183725 100 ug Ask for price
Anti-VDAC2 (Internal) antibody
STJ70995 100 µg
EUR 359
Polyclonal VDAC2 Antibody (C-Terminus)
APR10706G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VDAC2 (C-Terminus). This antibody is tested and proven to work in the following applications:
Vdac2 ORF Vector (Mouse) (pORF)
ORF061243 1.0 ug DNA
EUR 506
Vdac2 ORF Vector (Rat) (pORF)
ORF078781 1.0 ug DNA
EUR 506
VDAC2 ORF Vector (Human) (pORF)
ORF011432 1.0 ug DNA
EUR 95
VDAC2 ORF Vector (Human) (pORF)
ORF011433 1.0 ug DNA
EUR 95
Anti-VDAC2 (C Terminus) antibody
STJ70527 100 µg
EUR 359
Polyclonal Goat Anti-VDAC2 (Internal) Antibody
AMM05156G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VDAC2 (Internal) . This antibody is tested and proven to work in the following applications:
Vdac2 sgRNA CRISPR Lentivector set (Rat)
K7622101 3 x 1.0 ug
EUR 339
VDAC2 sgRNA CRISPR Lentivector set (Human)
K2608401 3 x 1.0 ug
EUR 339
Vdac2 sgRNA CRISPR Lentivector set (Mouse)
K4573601 3 x 1.0 ug
EUR 339
Monoclonal VDAC2 Antibody (monoclonal) (M01), Clone: 3D2
APR10707G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human VDAC2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3D2. This antibody is applicable in WB and IF, E
Voltage-Dependent Anion Channel 2 (VDAC2) Antibody
20-abx116629
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Polyclonal Goat Anti-VDAC2 (C Terminus) Antibody
AMM05155G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-VDAC2 (C Terminus) . This antibody is tested and proven to work in the following applications:
Vdac2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7622102 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7622103 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7622104 1.0 ug DNA
EUR 154
VDAC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2608402 1.0 ug DNA
EUR 154
VDAC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2608403 1.0 ug DNA
EUR 154
VDAC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2608404 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4573602 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4573603 1.0 ug DNA
EUR 154
Vdac2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4573604 1.0 ug DNA
EUR 154
VDAC2 Protein Vector (Mouse) (pPB-C-His)
PV244970 500 ng
EUR 603
VDAC2 Protein Vector (Mouse) (pPB-N-His)
PV244971 500 ng
EUR 603
VDAC2 Protein Vector (Mouse) (pPM-C-HA)
PV244972 500 ng
EUR 603
VDAC2 Protein Vector (Mouse) (pPM-C-His)
PV244973 500 ng
EUR 603
VDAC2 Protein Vector (Rat) (pPB-C-His)
PV315122 500 ng
EUR 603
VDAC2 Protein Vector (Rat) (pPB-N-His)
PV315123 500 ng
EUR 603
VDAC2 Protein Vector (Rat) (pPM-C-HA)
PV315124 500 ng
EUR 603
VDAC2 Protein Vector (Rat) (pPM-C-His)
PV315125 500 ng
EUR 603
VDAC2 Protein Vector (Human) (pPB-C-His)
PV045725 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPB-N-His)
PV045726 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPM-C-HA)
PV045727 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPM-C-His)
PV045728 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPB-C-His)
PV045729 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPB-N-His)
PV045730 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPM-C-HA)
PV045731 500 ng
EUR 329
VDAC2 Protein Vector (Human) (pPM-C-His)
PV045732 500 ng
EUR 329