UBE2R2

UBE2R2 Antibody
44699-50ul 50ul
EUR 187
UBE2R2 Antibody
DF2262 200ul
EUR 304
Description: UBE2R2 antibody detects endogenous levels of total UBE2R2.
UBE2R2 siRNA
20-abx938808
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2R2 siRNA
20-abx938809
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2R2 Antibody
ABD2262 100 ug
EUR 438
UBE2R2 Blocking Peptide
DF2262-BP 1mg
EUR 195
UBE2R2 Conjugated Antibody
C44699 100ul
EUR 397
UBE2R2 cloning plasmid
CSB-CL765138HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 717
  • Sequence: atggcccagcagcagatgaccagctcgcagaaggccctgatgctcgagctgaaatccctgcaggaggaaccggtggagggcttccggatcaccctggtggacgagtccgacctctacaactgggaggtggccatcttcggaccccccaacaccctctacgaaggcggctacttcaa
  • Show more
Description: A cloning plasmid for the UBE2R2 gene.
UBE2R2 Rabbit pAb
A7373-100ul 100 ul
EUR 308
UBE2R2 Rabbit pAb
A7373-200ul 200 ul
EUR 459
UBE2R2 Rabbit pAb
A7373-20ul 20 ul
EUR 183
UBE2R2 Rabbit pAb
A7373-50ul 50 ul
EUR 223
Anti-UBE2R2 antibody
STJ29510 100 µl
EUR 277
Description: Protein kinase CK2 is a ubiquitous and pleiotropic Ser/Thr protein kinase involved in cell growth and transformation. This gene encodes a protein similar to the E2 ubiquitin conjugating enzyme UBC3/CDC34. Studies suggest that CK2-dependent phosphorylation of this ubiquitin-conjugating enzyme functions by regulating beta-TrCP substrate recognition and induces its interaction with beta-TrCP, enhancing beta-catenin degradation.
Human recombinant UBE2R2 (Ubc3B)
6437-3
EUR 392
Polyclonal UBE2R2 Antibody (Center)
APR04467G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2R2 (Center). This antibody is tested and proven to work in the following applications:
UBE2R2 protein (His tag)
80R-3507 50 ug
EUR 424
Description: Purified recombinant UBE2R2 protein (His tag)
Mouse UBE2R2 shRNA Plasmid
20-abx976235
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UBE2R2 shRNA Plasmid
20-abx960328
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2R2 Recombinant Protein (Human)
RP033742 100 ug Ask for price
UBE2R2 Recombinant Protein (Mouse)
RP182720 100 ug Ask for price
UBE2R2 ORF Vector (Human) (pORF)
ORF011248 1.0 ug DNA
EUR 95
Ube2r2 ORF Vector (Mouse) (pORF)
ORF060908 1.0 ug DNA
EUR 506
Ube2r2 sgRNA CRISPR Lentivector set (Mouse)
K4799701 3 x 1.0 ug
EUR 339
UBE2R2 sgRNA CRISPR Lentivector set (Human)
K2574201 3 x 1.0 ug
EUR 339
Ubiquitin-Conjugating Enzyme E2 R2 (UBE2R2) Antibody
20-abx006931
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 R2 (UBE2R2) Antibody
20-abx149124
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 R2 (UBE2R2) Antibody
abx031194-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 R2 (UBE2R2) Antibody
abx031194-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Monoclonal UBE2R2 Antibody (monoclonal) (M01), Clone: 5E8
AMM04283G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human UBE2R2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5E8. This antibody is applicable in WB, IP, E
Ube2r2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4799702 1.0 ug DNA
EUR 154
Ube2r2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4799703 1.0 ug DNA
EUR 154
Ube2r2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4799704 1.0 ug DNA
EUR 154
UBE2R2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2574202 1.0 ug DNA
EUR 154
UBE2R2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2574203 1.0 ug DNA
EUR 154
UBE2R2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2574204 1.0 ug DNA
EUR 154
UBE2R2 Protein Vector (Mouse) (pPB-C-His)
PV243630 500 ng
EUR 603
UBE2R2 Protein Vector (Mouse) (pPB-N-His)
PV243631 500 ng
EUR 603
UBE2R2 Protein Vector (Mouse) (pPM-C-HA)
PV243632 500 ng
EUR 603
UBE2R2 Protein Vector (Mouse) (pPM-C-His)
PV243633 500 ng
EUR 603
UBE2R2 Protein Vector (Human) (pPB-C-His)
PV044989 500 ng
EUR 329
UBE2R2 Protein Vector (Human) (pPB-N-His)
PV044990 500 ng
EUR 329
UBE2R2 Protein Vector (Human) (pPM-C-HA)
PV044991 500 ng
EUR 329
UBE2R2 Protein Vector (Human) (pPM-C-His)
PV044992 500 ng
EUR 329
Recombinant Human UBE2R2 Protein, His, E.coli-10ug
QP13867-10ug 10ug
EUR 201
Recombinant Human UBE2R2 Protein, His, E.coli-1mg
QP13867-1mg 1mg
EUR 5251
Recombinant Human UBE2R2 Protein, His, E.coli-2ug
QP13867-2ug 2ug
EUR 155
Ube2r2 3'UTR Luciferase Stable Cell Line
TU121474 1.0 ml Ask for price
UBE2R2 3'UTR GFP Stable Cell Line
TU077685 1.0 ml
EUR 2333
Ube2r2 3'UTR GFP Stable Cell Line
TU171474 1.0 ml Ask for price
UBE2R2 3'UTR Luciferase Stable Cell Line
TU027685 1.0 ml
EUR 2333
Rabbit Ubiquitin- conjugating enzyme E2 R2, UBE2R2 ELISA KIT
ELI-23103Ra 96 Tests
EUR 928
Human Ubiquitin- conjugating enzyme E2 R2, UBE2R2 ELISA KIT
ELI-36619h 96 Tests
EUR 824
Mouse Ubiquitin- conjugating enzyme E2 R2, Ube2r2 ELISA KIT
ELI-36620m 96 Tests
EUR 865
UBE2R2 Ubiquitin Conjugating Enzyme E2R 2 Human Recombinant Protein
PROTQ712K3 Regular: 10ug
EUR 317
Description: UBE2R2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 261 amino acids (1-238 a.a) and having a molecular mass of 29.6kDa (Molecular size on SDS-PAGE will appear higher).
Ube2r2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4799705 3 x 1.0 ug
EUR 376
UBE2R2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2574205 3 x 1.0 ug
EUR 376
Ube2r2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4799706 1.0 ug DNA
EUR 167
Ube2r2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4799707 1.0 ug DNA
EUR 167
Ube2r2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4799708 1.0 ug DNA
EUR 167
UBE2R2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2574206 1.0 ug DNA
EUR 167
UBE2R2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2574207 1.0 ug DNA
EUR 167
UBE2R2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2574208 1.0 ug DNA
EUR 167