Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
DLR-SHC1-Hu-96T	DL Develop	96T	EUR 673
Should the Human SHC-Transforming Protein 1 (SHC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human SHC-Transforming Protein 1 (SHC1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
RD-SHC1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
RD-SHC1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
RDR-SHC1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
RDR-SHC1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Shc1/ Rat Shc1 ELISA Kit
ELI-52968r	Lifescience Market	96 Tests	EUR 886

Shc1 antibody
20R-2133	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal Shc1 antibody

Shc1 antibody
20R-2134	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal Shc1 antibody

Shc1 antibody
20R-2462	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal Shc1 antibody

Shc1 antibody
20R-2463	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal Shc1 antibody

SHC1 antibody
70R-20253	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SHC1 antibody

SHC1 antibody
10R-5763	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal SHC1 antibody

SHC1 antibody
10R-5765	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SHC1 antibody

SHC1 antibody
10R-5766	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SHC1 antibody

Shc1 antibody
10R-8484	Fitzgerald	100 ul	EUR 393
Description: Mouse monoclonal Shc1 antibody

SHC1 Antibody
48389-100ul	SAB	100ul	EUR 333

SHC1 Antibody
48389-50ul	SAB	50ul	EUR 239

SHC1 Antibody
1-CSB-PA004082	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

SHC1 Antibody
1-CSB-PA050055	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/20000

SHC1 antibody
70R-8909	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal SHC1 antibody

SHC1 Antibody
1-CSB-PA021253GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SHC1 Antibody
1-CSB-PA021253LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

SHC1 siRNA
20-abx904924	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SHC1 siRNA
20-abx933275	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SHC1 siRNA
20-abx933276	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SHC1 Blocking Peptide
33R-1145	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHB antibody, catalog no. 70R-5543

Shc1 antibody (Tyr349)
70R-37363	Fitzgerald	100 ug	EUR 349
Description: Rabbit Polyclonal Shc1 antibody (Tyr349)

Shc1 antibody (Tyr427)
70R-37364	Fitzgerald	100 ug	EUR 349
Description: Rabbit Polyclonal Shc1 antibody (Tyr427)

Mouse Shc1 Antibody
abx031129-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Shc1 Antibody
abx031129-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SHC1 Conjugated Antibody
C48389	SAB	100ul	EUR 397

SHC1 cloning plasmid
CSB-CL021253HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1425 Sequence: atgaacaagctgagtggaggcggcgggcgcaggactcgggtggaagggggccagcttgggggcgaggagtggacccgccacgggagctttgtcaataagcccacgcggggctggctgcatcccaacgacaaagtcatgggacccggggtttcctacttggttcggtacatgggtt Show more
Description: A cloning plasmid for the SHC1 gene.

SHC1 Rabbit pAb
A7725-100ul	Abclonal	100 ul	EUR 308

SHC1 Rabbit pAb
A7725-200ul	Abclonal	200 ul	EUR 459

SHC1 Rabbit pAb
A7725-20ul	Abclonal	20 ul	EUR 183

SHC1 Rabbit pAb
A7725-50ul	Abclonal	50 ul	EUR 223

SHC1 (pY349) Antibody
20-abx000316	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

SHC1 (pY427) Antibody
20-abx000317	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

anti-Shc1 (47F4)
LF-MA0201	Abfrontier	100 ul	EUR 334
Description: Mouse monoclonal to Shc1

Anti-SHC1 antibody
STJ110036	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene.

Shc1 (Ab-349) Antibody
21316-100ul	SAB	100ul	EUR 252

Shc1 (Ab-349) Antibody
21316-50ul	SAB	50ul	EUR 187

Shc1 (Ab-427) Antibody
21317-100ul	SAB	100ul	EUR 252

Shc1 (Ab-427) Antibody
21317-50ul	SAB	50ul	EUR 187

Shc1 (Phospho-Tyr349) Antibody
11316-100ul	SAB	100ul	EUR 252

Shc1 (Phospho-Tyr349) Antibody
11316-50ul	SAB	50ul	EUR 187

Shc1 (Phospho-Tyr427) Antibody
11317-100ul	SAB	100ul	EUR 252

Shc1 (Phospho-Tyr427) Antibody
11317-50ul	SAB	50ul	EUR 187

Phospho-SHC1 (Y427) Antibody
1-CSB-PA000671	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SHC1 (Y427). Recognizes Phospho-SHC1 (Y427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-SHC1 (Y349) Antibody
1-CSB-PA000670	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SHC1 (Y349). Recognizes Phospho-SHC1 (Y349) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-SHC1 (S36) Antibody
1-CSB-PA050054	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SHC1 (S36). Recognizes Phospho-SHC1 (S36) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

SHC1 (Ab-427) Antibody
CSB-PA065779-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SHC1 (Ab-427). Recognizes SHC1 (Ab-427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

SHC1 (Ab-427) Antibody
CSB-PA065779-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SHC1 (Ab-427). Recognizes SHC1 (Ab-427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

Phospho-SHC1 (Tyr349) Antibody
CSB-PA907557-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-SHC1 (Tyr349). Recognizes Phospho-SHC1 (Tyr349) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

Phospho-SHC1 (Tyr349) Antibody
CSB-PA907557-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-SHC1 (Tyr349). Recognizes Phospho-SHC1 (Tyr349) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

SHC1 (Ab-349) Antibody
CSB-PA208610-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SHC1 (Ab-349). Recognizes SHC1 (Ab-349) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

SHC1 (Ab-349) Antibody
CSB-PA208610-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against SHC1 (Ab-349). Recognizes SHC1 (Ab-349) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

Phospho-SHC1 (Tyr427) Antibody
CSB-PA216875-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-SHC1 (Tyr427). Recognizes Phospho-SHC1 (Tyr427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-SHC1 (Tyr427) Antibody
CSB-PA216875-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-SHC1 (Tyr427). Recognizes Phospho-SHC1 (Tyr427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

SHC1 protein (His tag)
80R-1884	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant SHC1 protein

SHC1 (pY349+T350) Antibody
abx218574-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Mouse SHC1 shRNA Plasmid
20-abx972677	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SHC1 shRNA Plasmid
20-abx987020	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SHC1 Antibody, HRP conjugated
1-CSB-PA021253LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SHC1 Antibody, FITC conjugated
1-CSB-PA021253LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SHC1 Antibody, Biotin conjugated
1-CSB-PA021253LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human SHC1 shRNA Plasmid
20-abx954370	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-SHC/SHC1 Antibody
PA1897	BosterBio	100ug/vial	EUR 294

anti-Shc1 (Ab-349)
LF-PA20447	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to Shc1

anti-Shc1 (Ab-427)
LF-PA20448	Abfrontier	100 ul	EUR 334
Description: Rabbit polyclonal to Shc1

anti-Shc1 (Phospho-Tyr349)
LF-PA20449	Abfrontier	100 ul	EUR 354
Description: Rabbit polyclonal to Shc1 (Phospho-Tyr349)

anti-Shc1 (Phospho-Tyr427)
LF-PA20450	Abfrontier	100 ul	EUR 354
Description: Rabbit polyclonal to Shc1 (Phospho-Tyr427)

Anti-SHC/SHC1 Antibody
PB9391	BosterBio	100ug/vial	EUR 334

Shc1 Recombinant Protein (Human)
RP028483	ABM	100 ug	Ask for price

Shc1 Recombinant Protein (Rat)
RP228614	ABM	100 ug	Ask for price

Shc1 Recombinant Protein (Rat)
RP228617	ABM	100 ug	Ask for price

Shc1 Recombinant Protein (Mouse)
RP171719	ABM	100 ug	Ask for price

Shc1 Recombinant Protein (Mouse)
RP171722	ABM	100 ug	Ask for price

SHC1 (Phospho-Tyr349+Tyr350) Antibody
12698-100ul	SAB	100ul	EUR 252

SHC1 (Phospho-Tyr349+Tyr350) Antibody
12698-50ul	SAB	50ul	EUR 187

Phospho-SHC1-Y317 Rabbit pAb
AP1107-100ul	Abclonal	100 ul	EUR 384

Phospho-SHC1-Y317 Rabbit pAb
AP1107-200ul	Abclonal	200 ul	EUR 554

Phospho-SHC1-Y317 Rabbit pAb
AP1107-20ul	Abclonal	20 ul	EUR 183

Phospho-SHC1-Y317 Rabbit pAb
AP1107-50ul	Abclonal	50 ul	EUR 265

Phospho-SHC1-Y349 Rabbit pAb
AP0265-100ul	Abclonal	100 ul	EUR 384