SHC1

Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
DLR-SHC1-Hu-96T 96T
EUR 673
  • Should the Human SHC-Transforming Protein 1 (SHC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human SHC-Transforming Protein 1 (SHC1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
RD-SHC1-Hu-48Tests 48 Tests
EUR 521
Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
RD-SHC1-Hu-96Tests 96 Tests
EUR 723
Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
RDR-SHC1-Hu-48Tests 48 Tests
EUR 544
Human SHC-Transforming Protein 1 (SHC1) ELISA Kit
RDR-SHC1-Hu-96Tests 96 Tests
EUR 756
Shc1/ Rat Shc1 ELISA Kit
ELI-52968r 96 Tests
EUR 886
Shc1 antibody
20R-2133 50 ug
EUR 281
Description: Rabbit polyclonal Shc1 antibody
Shc1 antibody
20R-2134 50 ug
EUR 281
Description: Rabbit polyclonal Shc1 antibody
Shc1 antibody
20R-2462 50 ug
EUR 281
Description: Rabbit polyclonal Shc1 antibody
Shc1 antibody
20R-2463 50 ug
EUR 281
Description: Rabbit polyclonal Shc1 antibody
SHC1 antibody
70R-20253 50 ul
EUR 435
Description: Rabbit polyclonal SHC1 antibody
SHC1 antibody
10R-5763 100 ul
EUR 726
Description: Mouse monoclonal SHC1 antibody
SHC1 antibody
10R-5765 100 ul
EUR 691
Description: Mouse monoclonal SHC1 antibody
SHC1 antibody
10R-5766 100 ul
EUR 691
Description: Mouse monoclonal SHC1 antibody
Shc1 antibody
10R-8484 100 ul
EUR 393
Description: Mouse monoclonal Shc1 antibody
SHC1 Antibody
48389-100ul 100ul
EUR 333
SHC1 Antibody
48389-50ul 50ul
EUR 239
SHC1 Antibody
1-CSB-PA004082
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
SHC1 Antibody
1-CSB-PA050055
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IP, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IP:2-5ug/mglysate.ELISA:1/20000
SHC1 antibody
70R-8909 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SHC1 antibody
SHC1 Antibody
1-CSB-PA021253GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SHC1 Antibody
1-CSB-PA021253LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
SHC1 siRNA
20-abx904924
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SHC1 siRNA
20-abx933275
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SHC1 siRNA
20-abx933276
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SHC1 Blocking Peptide
33R-1145 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHB antibody, catalog no. 70R-5543
Shc1 antibody (Tyr349)
70R-37363 100 ug
EUR 349
Description: Rabbit Polyclonal Shc1 antibody (Tyr349)
Shc1 antibody (Tyr427)
70R-37364 100 ug
EUR 349
Description: Rabbit Polyclonal Shc1 antibody (Tyr427)
Mouse Shc1 Antibody
abx031129-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Mouse Shc1 Antibody
abx031129-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SHC1 Conjugated Antibody
C48389 100ul
EUR 397
SHC1 cloning plasmid
CSB-CL021253HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1425
  • Sequence: atgaacaagctgagtggaggcggcgggcgcaggactcgggtggaagggggccagcttgggggcgaggagtggacccgccacgggagctttgtcaataagcccacgcggggctggctgcatcccaacgacaaagtcatgggacccggggtttcctacttggttcggtacatgggtt
  • Show more
Description: A cloning plasmid for the SHC1 gene.
SHC1 Rabbit pAb
A7725-100ul 100 ul
EUR 308
SHC1 Rabbit pAb
A7725-200ul 200 ul
EUR 459
SHC1 Rabbit pAb
A7725-20ul 20 ul
EUR 183
SHC1 Rabbit pAb
A7725-50ul 50 ul
EUR 223
SHC1 (pY349) Antibody
20-abx000316
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
SHC1 (pY427) Antibody
20-abx000317
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
anti-Shc1 (47F4)
LF-MA0201 100 ul
EUR 334
Description: Mouse monoclonal to Shc1
Anti-SHC1 antibody
STJ110036 100 µl
EUR 277
Description: This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene.
Shc1 (Ab-349) Antibody
21316-100ul 100ul
EUR 252
Shc1 (Ab-349) Antibody
21316-50ul 50ul
EUR 187
Shc1 (Ab-427) Antibody
21317-100ul 100ul
EUR 252
Shc1 (Ab-427) Antibody
21317-50ul 50ul
EUR 187
Shc1 (Phospho-Tyr349) Antibody
11316-100ul 100ul
EUR 252
Shc1 (Phospho-Tyr349) Antibody
11316-50ul 50ul
EUR 187
Shc1 (Phospho-Tyr427) Antibody
11317-100ul 100ul
EUR 252
Shc1 (Phospho-Tyr427) Antibody
11317-50ul 50ul
EUR 187
Phospho-SHC1 (Y427) Antibody
1-CSB-PA000671
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SHC1 (Y427). Recognizes Phospho-SHC1 (Y427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
Phospho-SHC1 (Y349) Antibody
1-CSB-PA000670
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SHC1 (Y349). Recognizes Phospho-SHC1 (Y349) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
Phospho-SHC1 (S36) Antibody
1-CSB-PA050054
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SHC1 (S36). Recognizes Phospho-SHC1 (S36) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000
SHC1 (Ab-427) Antibody
CSB-PA065779-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SHC1 (Ab-427). Recognizes SHC1 (Ab-427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200
SHC1 (Ab-427) Antibody
CSB-PA065779-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SHC1 (Ab-427). Recognizes SHC1 (Ab-427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200
Phospho-SHC1 (Tyr349) Antibody
CSB-PA907557-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-SHC1 (Tyr349). Recognizes Phospho-SHC1 (Tyr349) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200
Phospho-SHC1 (Tyr349) Antibody
CSB-PA907557-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-SHC1 (Tyr349). Recognizes Phospho-SHC1 (Tyr349) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200
SHC1 (Ab-349) Antibody
CSB-PA208610-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SHC1 (Ab-349). Recognizes SHC1 (Ab-349) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200
SHC1 (Ab-349) Antibody
CSB-PA208610-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SHC1 (Ab-349). Recognizes SHC1 (Ab-349) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200
Phospho-SHC1 (Tyr427) Antibody
CSB-PA216875-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-SHC1 (Tyr427). Recognizes Phospho-SHC1 (Tyr427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200
Phospho-SHC1 (Tyr427) Antibody
CSB-PA216875-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-SHC1 (Tyr427). Recognizes Phospho-SHC1 (Tyr427) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200
SHC1 protein (His tag)
80R-1884 100 ug
EUR 305
Description: Purified recombinant SHC1 protein
SHC1 (pY349+T350) Antibody
abx218574-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Mouse SHC1 shRNA Plasmid
20-abx972677
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat SHC1 shRNA Plasmid
20-abx987020
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SHC1 Antibody, HRP conjugated
1-CSB-PA021253LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SHC1 Antibody, FITC conjugated
1-CSB-PA021253LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SHC1 Antibody, Biotin conjugated
1-CSB-PA021253LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHC1. Recognizes SHC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SHC1 shRNA Plasmid
20-abx954370
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-SHC/SHC1 Antibody
PA1897 100ug/vial
EUR 294
anti-Shc1 (Ab-349)
LF-PA20447 100 ul
EUR 334
Description: Rabbit polyclonal to Shc1
anti-Shc1 (Ab-427)
LF-PA20448 100 ul
EUR 334
Description: Rabbit polyclonal to Shc1
anti-Shc1 (Phospho-Tyr349)
LF-PA20449 100 ul
EUR 354
Description: Rabbit polyclonal to Shc1 (Phospho-Tyr349)
anti-Shc1 (Phospho-Tyr427)
LF-PA20450 100 ul
EUR 354
Description: Rabbit polyclonal to Shc1 (Phospho-Tyr427)
Anti-SHC/SHC1 Antibody
PB9391 100ug/vial
EUR 334
Shc1 Recombinant Protein (Human)
RP028483 100 ug Ask for price
Shc1 Recombinant Protein (Rat)
RP228614 100 ug Ask for price
Shc1 Recombinant Protein (Rat)
RP228617 100 ug Ask for price
Shc1 Recombinant Protein (Mouse)
RP171719 100 ug Ask for price
Shc1 Recombinant Protein (Mouse)
RP171722 100 ug Ask for price
SHC1 (Phospho-Tyr349+Tyr350) Antibody
12698-100ul 100ul
EUR 252
SHC1 (Phospho-Tyr349+Tyr350) Antibody
12698-50ul 50ul
EUR 187
Phospho-SHC1-Y317 Rabbit pAb
AP1107-100ul 100 ul
EUR 384
Phospho-SHC1-Y317 Rabbit pAb
AP1107-200ul 200 ul
EUR 554
Phospho-SHC1-Y317 Rabbit pAb
AP1107-20ul 20 ul
EUR 183
Phospho-SHC1-Y317 Rabbit pAb
AP1107-50ul 50 ul
EUR 265
Phospho-SHC1-Y349 Rabbit pAb
AP0265-100ul 100 ul
EUR 384