  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALM1 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALM1 Antibody

ABD6319 100 ug
EUR 438

CALM1 antibody

38212-100ul 100ul
EUR 252

CALM1 antibody

70R-16130 50 ul
EUR 435
Description: Rabbit polyclonal CALM1 antibody

CALM1 Antibody

DF6319 200ul
EUR 304
Description: CALM1 Antibody detects endogenous levels of total CALM1.

CALM1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

CALM1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, WB

CALM1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CALM1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CALM1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

CALM1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA


PVT18301 2 ug
EUR 231

CALM1 Conjugated Antibody

C38212 100ul
EUR 397

CALM1 cloning plasmid

CSB-CL004445HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 342
  • Sequence: atgaggtcactgggtcagaacccaacagaagctgaattgcaggatatgatcaatgaagtggatgctgatggtaatggcaccattgacttccccgaatttttgactatgatggctagaaaaatgaaagatacagatagtgaagaagaaatccgtgaggcattccgagtctttgacaa
  • Show more
Description: A cloning plasmid for the CALM1 gene.

CALM1 cloning plasmid

CSB-CL004445HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 450
  • Sequence: atggctgatcagctgaccgaagaacagattgctgaattcaaggaagccttctccctatttgataaagatggcgatggcaccatcacaacaaaggaacttggaactgtcatgaggtcactgggtcagaacccaacagaagctgaattgcaggatatgatcaatgaagtggatgctga
  • Show more
Description: A cloning plasmid for the CALM1 gene.

CALM1 Rabbit mAb

A10769-100ul 100 ul
EUR 384

CALM1 Rabbit mAb

A10769-200ul 200 ul
EUR 554

CALM1 Rabbit mAb

A10769-20ul 20 ul Ask for price

CALM1 Rabbit mAb

A10769-50ul 50 ul
EUR 265

CALM1 Rabbit pAb

A1185-100ul 100 ul
EUR 308

CALM1 Rabbit pAb

A1185-200ul 200 ul
EUR 459

CALM1 Rabbit pAb

A1185-20ul 20 ul
EUR 183

CALM1 Rabbit pAb

A1185-50ul 50 ul
EUR 223

CALM1 Polyclonal Antibody

A58418 100 µg
EUR 570.55
Description: fast delivery possible

CALM1 Polyclonal Antibody

A51453 100 µg
EUR 570.55
Description: Ask the seller for details

CALM1 Polyclonal Antibody

A55511 100 µg
EUR 570.55
Description: fast delivery possible

CALM1 Polyclonal Antibody

A55759 100 µg
EUR 570.55
Description: kits suitable for this type of research

CALM1 Rabbit pAb

A14711-100ul 100 ul
EUR 308

CALM1 Rabbit pAb

A14711-200ul 200 ul
EUR 459

CALM1 Rabbit pAb

A14711-20ul 20 ul
EUR 183

CALM1 Rabbit pAb

A14711-50ul 50 ul
EUR 223

CALM1 Blocking Peptide

DF6319-BP 1mg
EUR 195

Human Calmodulin (CALM1)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Calmodulin(CALM1) expressed in Yeast

Human Calmodulin (CALM1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Calmodulin(CALM1) expressed in E.coli

Rat Calmodulin (Calm1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Calmodulin(Calm1) expressed in E.coli

Rat Calmodulin (Calm1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Calmodulin(Calm1) expressed in E.coli

pSV40- Calm1- m

PVT11632 2 ug
EUR 273


PVT13278 2 ug
EUR 391

Anti-CALM1 antibody

STJ22864 100 µl
EUR 277
Description: This gene encodes a member of the EF-hand calcium-binding protein family. It is one of three genes which encode an identical calcium binding protein which is one of the four subunits of phosphorylase kinase. Two pseudogenes have been identified on chromosome 7 and X. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALM1 antibody

STJ116911 100 µl
EUR 277
Description: This gene encodes a member of the EF-hand calcium-binding protein family. It is one of three genes which encode an identical calcium binding protein which is one of the four subunits of phosphorylase kinase. Two pseudogenes have been identified on chromosome 7 and X. Multiple transcript variants encoding different isoforms have been found for this gene.

Recombinant Human Calmodulin/CALM1

C911-10ug 10ug
EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of 50mM NH4HCO3, pH 8.0.

Recombinant Human Calmodulin/CALM1

C911-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of 50mM NH4HCO3, pH 8.0.

Recombinant Human Calmodulin/CALM1

C911-500ug 500ug
EUR 1318
Description: Lyophilized from a 0.2 μm filtered solution of 50mM NH4HCO3, pH 8.0.

Recombinant Human Calmodulin/CALM1

C911-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of 50mM NH4HCO3, pH 8.0.

Rat CALM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E0640h 96 Tests
EUR 824


EF000290 96 Tests
EUR 689

Calmodulin 1 (CALM1) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calmodulin 1 (CALM1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calmodulin 1 (CALM1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calmodulin 1 (CALM1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calmodulin 1 (CALM1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calmodulin 1 (CALM1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calmodulin 1 (CALM1) Antibody

abx033991-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calmodulin 1 (CALM1) Antibody

abx033991-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CALM1 (pT80 / S82) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CALM1 (pT79 / pS81) Antibody

abx333461-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Calmodulin 1 (CALM1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human CALM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CALM1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALM1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALM1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALM1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALM1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALM1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALM1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALM1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALM1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALM1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALM1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALM1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALM1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALM1. Recognizes CALM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Recombinant Calmodulin 1 (CALM1)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62149
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.1kDa
  • Isoelectric Point: 4.4
Description: Recombinant Chicken Calmodulin 1 expressed in: E.coli

Recombinant Calmodulin 1 (CALM1)

  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62158
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Calmodulin 1 expressed in: E.coli

Recombinant Calmodulin 1 (CALM1)

  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62158
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Calmodulin 1 expressed in: E.coli

Recombinant Calmodulin 1 (CALM1)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62161
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Calmodulin 1 expressed in: E.coli

CALM1 Recombinant Protein (Human)

RP005476 100 ug Ask for price

CALM1 Recombinant Protein (Human)

RP005479 100 ug Ask for price

CALM1 Recombinant Protein (Rat)

RP192923 100 ug Ask for price

CALM1 Recombinant Protein (Mouse)

RP120830 100 ug Ask for price

Polyclonal CALM1 Antibody (C-term)

APG02336G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALM1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Acetyl-CALM1(K116) Antibody

APG01481G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Acetyl-CALM1(K116) . This antibody is tested and proven to work in the following applications:

Cow Calmodulin (CALM1) ELISA Kit

abx513590-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Calmodulin (CALM1) ELISA Kit

abx513591-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Calmodulin (CALM1) ELISA Kit

abx513593-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Calmodulin (CALM1) ELISA Kit

abx513594-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Calmodulin (CALM1) ELISA Kit

abx576514-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GCNT7 antibody

70R-51186 100 ul
EUR 244
Description: Purified Polyclonal GCNT7 antibody

GCNT7 antibody

70R-35013 100 ug
EUR 327
Description: Purified Rabbit polyclonal GCNT7 antibody

GCNT7 Antibody

ABD3832 100 ug
EUR 438

GCNT7 Antibody

34485-100ul 100ul
EUR 252

GCNT7 Antibody

34485-50ul 50ul
EUR 187

GCNT7 Antibody

DF3832 200ul
EUR 304
Description: GCNT7 Antibody detects endogenous levels of total GCNT7.

GCNT7 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GCNT7. Recognizes GCNT7 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

GCNT7 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GCNT7. Recognizes GCNT7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

GCNT7 Antibody

CSB-PA596794-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GCNT7. Recognizes GCNT7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

GCNT7 Conjugated Antibody

C34485 100ul
EUR 397

GCNT7 Polyclonal Antibody

ES4825-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GCNT7 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

GCNT7 Polyclonal Antibody

ES4825-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GCNT7 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

GCNT7 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GCNT7 Polyclonal Antibody

ABP53826-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GCNT7 at AA rangle: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of GCNT7 from Human. This GCNT7 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GCNT7 at AA rangle: 280-360

GCNT7 Polyclonal Antibody

ABP53826-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GCNT7 at AA rangle: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of GCNT7 from Human. This GCNT7 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GCNT7 at AA rangle: 280-360

GCNT7 Polyclonal Antibody

ABP53826-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human GCNT7 at AA rangle: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of GCNT7 from Human. This GCNT7 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human GCNT7 at AA rangle: 280-360

Anti-GCNT7 Antibody

A17504 100ul
EUR 397
Description: Rabbit Polyclonal GCNT7 Antibody. Validated in IF, IHC, WB and tested in Human.

GCNT7 Blocking Peptide

DF3832-BP 1mg
EUR 195

Anti-GCNT7 antibody

STJ93243 200 µl
EUR 197
Description: Rabbit polyclonal to GCNT7.

Mouse GCNT7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GCNT7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-26545h 96 Tests
EUR 824

Mouse Gcnt7 ELISA KIT

ELI-27318m 96 Tests
EUR 865

GCNT7 Recombinant Protein (Human)

RP060300 100 ug Ask for price

GCNT7 Recombinant Protein (Mouse)

RP136181 100 ug Ask for price

Gcnt7 ORF Vector (Mouse) (pORF)

ORF045395 1.0 ug DNA
EUR 506

GCNT7 ORF Vector (Human) (pORF)

ORF020101 1.0 ug DNA Ask for price

GCNT7 sgRNA CRISPR Lentivector set (Human)

K0848201 3 x 1.0 ug
EUR 339

Gcnt7 sgRNA CRISPR Lentivector set (Mouse)

K3914101 3 x 1.0 ug
EUR 339

GCNT7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0848202 1.0 ug DNA
EUR 154

GCNT7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0848203 1.0 ug DNA
EUR 154

GCNT7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0848204 1.0 ug DNA
EUR 154

Gcnt7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3914102 1.0 ug DNA
EUR 154

Gcnt7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3914103 1.0 ug DNA
EUR 154

Gcnt7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3914104 1.0 ug DNA
EUR 154

GCNT7 Protein Vector (Human) (pPB-C-His)

PV080401 500 ng Ask for price

GCNT7 Protein Vector (Human) (pPB-N-His)

PV080402 500 ng Ask for price

GCNT7 Protein Vector (Human) (pPM-C-HA)

PV080403 500 ng Ask for price

GCNT7 Protein Vector (Human) (pPM-C-His)

PV080404 500 ng Ask for price

GCNT7 Protein Vector (Mouse) (pPB-C-His)

PV181578 500 ng
EUR 603

GCNT7 Protein Vector (Mouse) (pPB-N-His)

PV181579 500 ng
EUR 603

GCNT7 Protein Vector (Mouse) (pPM-C-HA)

PV181580 500 ng
EUR 603

GCNT7 Protein Vector (Mouse) (pPM-C-His)

PV181581 500 ng
EUR 603

Gcnt7 3'UTR GFP Stable Cell Line

TU156980 1.0 ml Ask for price

GCNT7 3'UTR Luciferase Stable Cell Line

TU008694 1.0 ml
EUR 1394

Gcnt7 3'UTR Luciferase Stable Cell Line

TU106980 1.0 ml Ask for price

GCNT7 3'UTR GFP Stable Cell Line

TU058694 1.0 ml
EUR 1394

Glucosaminyl (N-Acetyl) Transferase Family Member 7 (GCNT7) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glucosaminyl (N-Acetyl) Transferase Family Member 7 (GCNT7) Antibody

abx330551-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

GCNT7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0848205 3 x 1.0 ug
EUR 376

Gcnt7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3914105 3 x 1.0 ug
EUR 376

GCNT7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0848206 1.0 ug DNA
EUR 167

GCNT7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0848207 1.0 ug DNA
EUR 167

GCNT7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0848208 1.0 ug DNA
EUR 167

Gcnt7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3914106 1.0 ug DNA
EUR 167

Gcnt7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3914107 1.0 ug DNA
EUR 167

Gcnt7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3914108 1.0 ug DNA
EUR 167

Beta-1,3-Galactosyl-O-Glycosyl-Glycoprotein Beta-1,6-N-Acetylglucosaminyltransferase 7 (GCNT7) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Beta-1,3-Galactosyl-O-Glycosyl-Glycoprotein Beta-1,6-N-Acetylglucosaminyltransferase 7 (GCNT7) Antibody

abx030450-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Beta-1,3-Galactosyl-O-Glycosyl-Glycoprotein Beta-1,6-N-Acetylglucosaminyltransferase 7 (GCNT7) Antibody

abx030450-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Beta-1,3-Galactosyl-O-Glycosyl-Glycoprotein Beta-1,6-N-Acetylglucosaminyltransferase 7 (GCNT7) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Goat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) ELISA kit

E06B0914-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) ELISA kit

E06B0914-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) ELISA kit

E06B0914-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β 1,3 galactosyl O glycosyl glycoprotein β 1,6 N acetylglucosaminyltransferase 7(GCNT7) ELISA kit

E06B0702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β 1,3 galactosyl O glycosyl glycoprotein β 1,6 N acetylglucosaminyltransferase 7(GCNT7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β 1,3 galactosyl O glycosyl glycoprotein β 1,6 N acetylglucosaminyltransferase 7(GCNT7) ELISA kit

E06B0702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β 1,3 galactosyl O glycosyl glycoprotein β 1,6 N acetylglucosaminyltransferase 7(GCNT7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β 1,3 galactosyl O glycosyl glycoprotein β 1,6 N acetylglucosaminyltransferase 7(GCNT7) ELISA kit

E06B0702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat β 1,3 galactosyl O glycosyl glycoprotein β 1,6 N acetylglucosaminyltransferase 7(GCNT7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) ELISA kit

E02B0914-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) ELISA kit

E02B0914-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 7(GCNT7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


CBX2 Antibody

31050-50ul 50ul
EUR 187

CBX2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

CBX2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CBX2 Antibody

DF9380 200ul
EUR 304
Description: CBX2 Antibody detects endogenous levels of total CBX2.

CBX2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CBX2 Antibody

ABD9380 100 ug
EUR 438

CBX2 polyclonal antibody

EUR 251

CBX2 Blocking Peptide

DF9380-BP 1mg
EUR 195

CBX2 Conjugated Antibody

C31050 100ul
EUR 397

CBX2 cloning plasmid

CSB-CL613521HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 636
  • Sequence: atggaggagctgagcagcgtgggcgagcaggtcttcgccgccgagtgcatcctgagcaagcggctccgcaagggcaagctggagtacctggtcaagtggcgcggctggtcctccaaacataacagctgggagccggaggagaacatcctggacccgaggctgctcctggccttcca
  • Show more
Description: A cloning plasmid for the CBX2 gene.

CBX2 Polyclonal Antibody

A58442 100 µg
EUR 570.55
Description: Ask the seller for details

CBX2 Rabbit pAb

A2683-100ul 100 ul
EUR 308

CBX2 Rabbit pAb

A2683-200ul 200 ul
EUR 459

CBX2 Rabbit pAb

A2683-20ul 20 ul
EUR 183

CBX2 Rabbit pAb

A2683-50ul 50 ul
EUR 223

CBX2 Polyclonal Antibody

ABP56780-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2
  • Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody

ABP56780-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2
  • Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody

ABP56780-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2
  • Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody

ES7779-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CBX2 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

CBX2 Polyclonal Antibody

ES7779-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CBX2 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

anti- CBX2 antibody

FNab01329 100µg
EUR 505.25
  • Immunogen: chromobox homolog 2(Pc class homolog, Drosophila)
  • Uniprot ID: Q14781
  • Gene ID: 84733
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against CBX2

Anti-CBX2 antibody

PAab01329 100 ug
EUR 355

Anti-CBX2 antibody

STJ111164 100 µl
EUR 277
Description: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in mice results in male-to-female gonadal sex reversal. Mutations in this gene are also associated with gonadal dysgenesis in humans. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Anti-CBX2 antibody

STJ92063 200 µl
EUR 197
Description: Rabbit polyclonal to CBX2.

Anti-CBX2 (3E2)

YF-MA19571 100 ug
EUR 363
Description: Mouse monoclonal to CBX2

Anti-CBX2 (1E9)

YF-MA20596 100 ug
EUR 363
Description: Mouse monoclonal to CBX2

CBX2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CBX2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CBX2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Chromobox 2 (CBX2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


EF008422 96 Tests
EUR 689

Chromobox 2 (CBX2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse CBX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CBX2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pcDNA6-Flag-CBX2 Plasmid

PVTB00735-2a 2 ug
EUR 356

CBX2 Recombinant Protein (Human)

RP005752 100 ug Ask for price

CBX2 Recombinant Protein (Rat)

RP193319 100 ug Ask for price

CBX2 Recombinant Protein (Mouse)

RP121445 100 ug Ask for price

Chromobox Homolog 2 (CBX2) Antibody

abx016180-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx224211-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx146269-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx029317-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx029317-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx034438-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx034438-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx231329-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CBX2 Polyclonal Antibody, Biotin Conjugated

A58443 100 µg
EUR 570.55
Description: The best epigenetics products

CBX2 Polyclonal Antibody, FITC Conjugated

A58444 100 µg
EUR 570.55
Description: kits suitable for this type of research

CBX2 Polyclonal Antibody, HRP Conjugated

A58445 100 µg
EUR 570.55
Description: fast delivery possible

Cbx2 ORF Vector (Rat) (pORF)

ORF064441 1.0 ug DNA
EUR 506

CBX2 ORF Vector (Human) (pORF)

ORF001918 1.0 ug DNA
EUR 95

Cbx2 ORF Vector (Mouse) (pORF)

ORF040483 1.0 ug DNA
EUR 506

Chromobox Protein Homolog 2 (CBX2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CBX2 sgRNA CRISPR Lentivector set (Human)

K0370601 3 x 1.0 ug
EUR 339

Cbx2 sgRNA CRISPR Lentivector set (Rat)

K7569601 3 x 1.0 ug
EUR 339

Cbx2 sgRNA CRISPR Lentivector set (Mouse)

K4381901 3 x 1.0 ug
EUR 339

Human Chromobox Homolog 2 (CBX2)ELISA Kit

201-12-2895 96 tests
EUR 440
  • This Chromobox Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Chromobox Protein Homolog 2 (CBX2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 2 (CBX2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 2 (CBX2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Chromobox Homolog 2 (CBX2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

CBX2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0370602 1.0 ug DNA
EUR 154

CBX2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0370603 1.0 ug DNA
EUR 154

CBX2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0370604 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7569602 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7569603 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7569604 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4381902 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4381903 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4381904 1.0 ug DNA
EUR 154

CBX2 Protein Vector (Mouse) (pPB-C-His)

PV161930 500 ng
EUR 603

CBX2 Protein Vector (Mouse) (pPB-N-His)

PV161931 500 ng
EUR 603

CBX2 Protein Vector (Mouse) (pPM-C-HA)

PV161932 500 ng
EUR 603

CBX2 Protein Vector (Mouse) (pPM-C-His)

PV161933 500 ng
EUR 603

CBX2 Protein Vector (Rat) (pPB-C-His)

PV257762 500 ng
EUR 603

CBX2 Protein Vector (Rat) (pPB-N-His)

PV257763 500 ng
EUR 603

CBX2 Protein Vector (Rat) (pPM-C-HA)

PV257764 500 ng
EUR 603

CBX2 Protein Vector (Rat) (pPM-C-His)

PV257765 500 ng
EUR 603

Human Chromobox Homolog 2(CBX2)ELISA Kit

QY-E01795 96T
EUR 361

CBX2 Protein Vector (Human) (pPB-C-His)

PV007669 500 ng
EUR 329

CBX2 Protein Vector (Human) (pPB-N-His)

PV007670 500 ng
EUR 329

CBX2 Protein Vector (Human) (pPM-C-HA)

PV007671 500 ng
EUR 329

CBX2 Protein Vector (Human) (pPM-C-His)

PV007672 500 ng
EUR 329

Cbx2 3'UTR GFP Stable Cell Line

TU153200 1.0 ml Ask for price

Cbx2 3'UTR Luciferase Stable Cell Line

TU103200 1.0 ml Ask for price

Cbx2 3'UTR Luciferase Stable Cell Line

TU201721 1.0 ml Ask for price

Cbx2 3'UTR GFP Stable Cell Line

TU251721 1.0 ml Ask for price


PIGM antibody

70R-19284 50 ul
EUR 435
Description: Rabbit polyclonal PIGM antibody

PIGM Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PIGM. Recognizes PIGM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA26792 50 ul
EUR 334
Description: Mouse polyclonal to PIGM

PIGM Polyclonal Antibody

30190-100ul 100ul
EUR 252

PIGM Polyclonal Antibody

30190-50ul 50ul
EUR 187

PIGM cloning plasmid

CSB-CL875667HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atgggctccaccaagcactggggcgaatggctcctgaacttgaaggtggctccagccggcgtctttggtgtggcctttctagccagagtcgccctggttttctatggcgtcttccaggaccggaccctgcacgtgaggtatacggacatcgactaccaggtcttcaccgacgccg
  • Show more
Description: A cloning plasmid for the PIGM gene.

PIGM Rabbit pAb

A17811-100ul 100 ul
EUR 308

PIGM Rabbit pAb

A17811-200ul 200 ul
EUR 459

PIGM Rabbit pAb

A17811-20ul 20 ul
EUR 183

PIGM Rabbit pAb

A17811-50ul 50 ul
EUR 223

anti- PIGM antibody

FNab06442 100µg
EUR 548.75
  • Immunogen: phosphatidylinositol glycan anchor biosynthesis, class M
  • Uniprot ID: Q9H3S5
  • Gene ID: 93183
  • Research Area: Metabolism
Description: Antibody raised against PIGM

Anti-PIGM antibody

PAab06442 100 ug
EUR 386

Anti-PIGM antibody

STJ119837 100 µl
EUR 277
Description: This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI)-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes a mannosyltransferase, GPI-MT-I, that transfers the first mannose to GPI on the lumenal side of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]


EF001779 96 Tests
EUR 689

Mouse PIGM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIGM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PIGM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGM Polyclonal Conjugated Antibody

C30190 100ul
EUR 397


PVT16195 2 ug
EUR 325

PIGM Recombinant Protein (Human)

RP023461 100 ug Ask for price

PIGM Recombinant Protein (Mouse)

RP162044 100 ug Ask for price

PIGM Recombinant Protein (Rat)

RP220481 100 ug Ask for price

Pigm ORF Vector (Rat) (pORF)

ORF073495 1.0 ug DNA
EUR 506

PIGM ORF Vector (Human) (pORF)

ORF007821 1.0 ug DNA
EUR 95

Pigm ORF Vector (Mouse) (pORF)

ORF054016 1.0 ug DNA
EUR 506

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx032299-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx032299-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phosphatidylinositol Glycan, Class M (PIGM) Antibody

abx236442-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Pigm sgRNA CRISPR Lentivector set (Rat)

K7119501 3 x 1.0 ug
EUR 339

Pigm sgRNA CRISPR Lentivector set (Mouse)

K3485101 3 x 1.0 ug
EUR 339

PIGM sgRNA CRISPR Lentivector set (Human)

K1647701 3 x 1.0 ug
EUR 339

Bovine GPI mannosyltransferase 1, PIGM ELISA KIT

ELI-16385b 96 Tests
EUR 928

Chicken GPI mannosyltransferase 1, PIGM ELISA KIT

ELI-12684c 96 Tests
EUR 928

Human GPI mannosyltransferase 1, PIGM ELISA KIT

ELI-36405h 96 Tests
EUR 824

Mouse GPI mannosyltransferase 1, Pigm ELISA KIT

ELI-36406m 96 Tests
EUR 865

Pigm sgRNA CRISPR Lentivector (Rat) (Target 1)

K7119502 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Rat) (Target 2)

K7119503 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Rat) (Target 3)

K7119504 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3485102 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3485103 1.0 ug DNA
EUR 154

Pigm sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3485104 1.0 ug DNA
EUR 154

PIGM sgRNA CRISPR Lentivector (Human) (Target 1)

K1647702 1.0 ug DNA
EUR 154

PIGM sgRNA CRISPR Lentivector (Human) (Target 2)

K1647703 1.0 ug DNA
EUR 154

PIGM sgRNA CRISPR Lentivector (Human) (Target 3)

K1647704 1.0 ug DNA
EUR 154

PIGM Protein Vector (Rat) (pPB-C-His)

PV293978 500 ng
EUR 603

PIGM Protein Vector (Rat) (pPB-N-His)

PV293979 500 ng
EUR 603

PIGM Protein Vector (Rat) (pPM-C-HA)

PV293980 500 ng
EUR 603

PIGM Protein Vector (Rat) (pPM-C-His)

PV293981 500 ng
EUR 603

PIGM Protein Vector (Human) (pPB-C-His)

PV031281 500 ng
EUR 329

PIGM Protein Vector (Human) (pPB-N-His)

PV031282 500 ng
EUR 329

PIGM Protein Vector (Human) (pPM-C-HA)

PV031283 500 ng
EUR 329


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBCB antibody
70R-3673 50 ug
EUR 467
Description: Rabbit polyclonal TBCB antibody raised against the C terminal of TBCB
TBCB antibody
70R-20714 50 ul
EUR 435
Description: Rabbit polyclonal TBCB antibody
TBCB antibody
70R-9129 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TBCB antibody
TBCB Antibody
46681-100ul 100ul
EUR 252
TBCB antibody
10R-10259 50 ul
EUR 219
Description: Mouse monoclonal TBCB antibody
TBCB Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
TBCB Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCB. Recognizes TBCB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000
TBCB Conjugated Antibody
C46681 100ul
EUR 397
anti- TBCB antibody