TMB Solution (500 mL Part A & 500 mL Part B)

This is a predefined sub-study of the Endothelial Dysfunction in Resuscitated Cardiac Arrest (ENDO-RCA) trial.

We aim to investigate Iloprost, a prostacyclin analogue, safety by evaluating change in whole blood platelet aggregometry (Multiplate) in out of hospital cardiac arrest (OHCA) patients from baseline to 96-h post randomization.A randomized, placebo controlled double-blinded trial in 46 OHCA patients. Patients were allocated 1:2 to 48 h Iloprost infusion, (1 ng/kg/min) or placebo (saline infusion). Platelet aggregation was determined by platelet aggregation tests ASPI-test (arachidonic acid); TRAP-test (thrombin-receptor activating peptide (TRAP)-6; RISTO test (Ristocetin); ADP test (adenosin diphosphat).

There was no significant difference between the iloprost and placebo groups according to ASPI, TRAP, RISTO and ADP platelet aggregation assays. Further, no significant differences regarding risk of bleeding were found between groups (Risk of bleeding: ASPI <40 U; TRAP <92 U; RISTO <35 U; ADP <50 U).

In conclusion, the iloprost infusion did not influence platelet aggregation as evaluated by the ASPI, TRAP, RISTO and ADP assays. There was no increased risk of bleeding or transfusion therapy. A decline in platelet aggregation was observed for the ASPI and ADP assays during the initial 96 h after OHCA.Trial registration at (identifier NCT02685618) on 18-02-2016.


HE084017-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE084081-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE002059-2K-500mg 500mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL001044-2K-100mg 100mg
EUR 383
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


MF001048-2K-100mg 100mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE009074-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE041057-2K-100mg 100mg
EUR 520
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE048003-2K-100mg 100mg
EUR 642
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE048022-2K-100mg 100mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE048023-2K-100mg 100mg
EUR 691
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE057003-2K-100mg 100mg
EUR 371
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE057004-2K-100mg 100mg
EUR 403
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE057007-2K-100mg 100mg
EUR 416
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE057017-2K-100mg 100mg
EUR 377
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE057023-2K-100mg 100mg
EUR 377
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE084005-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HO002002-2K-10g 10g
EUR 283
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HO070070-2K-1g 1g
EUR 306
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE003019-2K-1g1050 1g1050
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE005048-2K-500G 500G
EUR 1110
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE005072-2K-1g 1g
EUR 359
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044002-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044003-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044007-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044017-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044022-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044023-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044041-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044057-2K-100mg 100mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL044076-2K-100mg 100mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL045002-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL045003-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL045017-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL045022-2K-50mg 50mg
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL045023-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL045041-2K-50mg 50mg
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL045096-2K-100mg 100mg
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL077002-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL077003-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL077017-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL077022-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL077023-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL077041-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL078003-2K-50mg 50mg
EUR 568
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL078017-2K-50mg 50mg
EUR 470
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL078022-2K-50mg 50mg
EUR 470
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL079003-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL079057-2K-100mg 100mg
EUR 790
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL080096-2K-50mg 50mg
EUR 494
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


FL096044-2K-100mg 100mg
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP095022-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP095041-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP095044-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP095057-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP096007-2K-g g
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-Dopamine, 2K

LP096047-2K-100mg 100mg
EUR 568
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP096072-2K-1g 1g
EUR 852
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP096074-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP096094-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP101017-2K-g g
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SS-C30, 2K

MF001092-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE062022-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE083017-2K-500mg 500mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE085017-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE085022-2K-500mg 500mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE085023-2K-500mg 500mg
EUR 691
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PCL(5K)-PEG-Galactose, 2K

HE116072-2K-G G
EUR 359
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


LP096105-2K-500mg 500mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


HE086022-2K-500mg 500mg
EUR 642
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

2K antibody

10R-7771 500 ug
EUR 565
Description: Mouse monoclonal 2K antibody

2K DNA Marker

  • EUR 258.00
  • EUR 189.00
  • 2.5 ml
  • 500 ul
  • Shipped within 5-10 working days.


  • EUR 667.00
  • EUR 1899.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 235.00
  • EUR 482.00
  • 10g
  • 50g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 494.00
  • EUR 198.00
  • 5G
  • G
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 100.00
  • EUR 198.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 667.00
  • EUR 1899.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 211.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 285.00
  • EUR 753.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


abx085318-2kDa500mg 2 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


abx085318-34kDa500mg 3.4 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


abx085318-5kDa500mg 5 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


abx085320-2kDa500mg 2 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


abx085320-34kDa500mg 3.4 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


abx085320-5kDa500mg 5 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


abx085321-10kDa500mg 10 kDa; 500 mg
EUR 871
  • Shipped within 5-10 working days.


abx085321-2kDa500mg 2 kDa; 500 mg
EUR 871
  • Shipped within 5-10 working days.


abx085321-34kDa500mg 3.4 kDa; 500 mg
EUR 871
  • Shipped within 5-10 working days.


abx085321-5kDa500mg 5 kDa; 500 mg
EUR 871
  • Shipped within 5-10 working days.


abx085325-10kDa500mg 10 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


abx085325-2kDa500mg 2 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


abx085325-5kDa500mg 5 kDa; 500 mg
EUR 954
  • Shipped within 5-10 working days.


  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 137.00
  • EUR 309.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 223.00
  • EUR 568.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.


Platelet function testing is a cornerstone in the diagnostic investigation of patients with a bleeding history. Multiple electrode aggregometry (MEA) has been shown to detect von Willebrand disease (VWD), platelet function disorders, and drug-induced bleeding disorders. However, there are few studies supporting its successful use in children. We have implemented and used MEA over 3 years in our hemostasis laboratory in order to study its usefulness to supplement and expedite diagnosis.

This is a retrospective, single-center, cohort study of 109 hospitalized children who underwent a laboratory investigation of hemostasis and either had a reported bleeding history or an abnormal bleeding episode.

Plasmatic coagulation testing, blood counts, plasmatic von Willebrand testing, platelet function analyzer (PFA-100), and impedance aggregometry (MEA) were performed in all children. Light transmission aggregometry testing was performed as needed.

In 41 cases (37.6%), a working diagnosis was made; a primary hemostatic disorder was detected in 35 children (VWD (n = 16), platelet disorder (n = 15), and valproic acid therapy-induced bleeding disorder (n = 3), acetylsalicylic acid-related bleeding (n = 1). In patients diagnosed with VWD, MEA ristocetin-induced platelet aggregation test (RISTO) high test revealed abnormally low aggregation in six patients (43.8%); whereas in patients diagnosed with a platelet function disorder, abnormally low values were found by MEA in only three children (20%).

Three of the four children with laboratory evidence of drug-induced platelet dysfunction had abnormalities on MEA.

There were no cases in which an abnormal MEA result was used to make a previously undetermined diagnosis. Retrospectively, MEA has demonstrated limited additional diagnostic value beyond standard laboratory testing for detecting defects of primary hemostasis in children.


Product not found


COG3 antibody

70R-16492 50 ul
EUR 435
Description: Rabbit polyclonal COG3 antibody

COG3 Antibody

DF12905 200ul
EUR 304
Description: COG3 Antibody detects endogenous levels of COG3.

COG3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

COG3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


YF-PA21221 50 ul
EUR 363
Description: Mouse polyclonal to COG3


YF-PA27635 50 ug
EUR 363
Description: Mouse polyclonal to COG3

anti- COG3 antibody

FNab01829 100µg
EUR 505.25
  • Immunogen: component of oligomeric golgi complex 3
  • Uniprot ID: Q96JB2
  • Gene ID: 83548
  • Research Area: Signal Transduction
Description: Antibody raised against COG3

COG3 Rabbit pAb

A17785-100ul 100 ul
EUR 308

COG3 Rabbit pAb

A17785-200ul 200 ul
EUR 459

COG3 Rabbit pAb

A17785-20ul 20 ul
EUR 183

COG3 Rabbit pAb

A17785-50ul 50 ul
EUR 223

COG3 Polyclonal Antibody

A66598 100 µg
EUR 570.55
Description: reagents widely cited

COG3 Polyclonal Antibody

30178-100ul 100ul
EUR 252

COG3 Polyclonal Antibody

30178-50ul 50ul
EUR 187

COG3 Blocking Peptide

DF12905-BP 1mg
EUR 195

COG3 cloning plasmid

CSB-CL839348HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1335
  • Sequence: atggcggaggcggcgctgttgctgctgcctgaggcggcggcggagcgggacgctagggaaaagctggctctctgggatcggagaccggacacgacggcgccgctgaccgacaggcagacggactcggtattggagctgaaggcggcggcagagaacttgccggtgccagctgagc
  • Show more
Description: A cloning plasmid for the COG3 gene.

Anti-COG3 antibody

PAab01829 100 ug
EUR 355

Anti-COG3 antibody

STJ119817 100 µl
EUR 277
Description: This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]

Anti-COG3 (2G7)

YF-MA19468 100 ug
EUR 363
Description: Mouse monoclonal to COG3

COG3 Polyclonal Conjugated Antibody

C30178 100ul
EUR 397

Human COG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF008776 96 Tests
EUR 689

COG3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

COG3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

COG3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COG3. Recognizes COG3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

COG3 Recombinant Protein (Human)

RP007579 100 ug Ask for price

COG3 Recombinant Protein (Rat)

RP195749 100 ug Ask for price

COG3 Recombinant Protein (Mouse)

RP125231 100 ug Ask for price

COG3 Polyclonal Antibody, HRP Conjugated

A66599 100 µg
EUR 570.55
Description: Ask the seller for details

COG3 Polyclonal Antibody, FITC Conjugated

A66600 100 µg
EUR 570.55
Description: The best epigenetics products

COG3 Polyclonal Antibody, Biotin Conjugated

A66601 100 µg
EUR 570.55
Description: kits suitable for this type of research

COG3 ORF Vector (Human) (pORF)

ORF002527 1.0 ug DNA
EUR 95

Cog3 ORF Vector (Rat) (pORF)

ORF065251 1.0 ug DNA
EUR 506

Cog3 ORF Vector (Mouse) (pORF)

ORF041745 1.0 ug DNA
EUR 506

COG3 sgRNA CRISPR Lentivector set (Human)

K0481001 3 x 1.0 ug
EUR 339

Cog3 sgRNA CRISPR Lentivector set (Mouse)

K3568401 3 x 1.0 ug
EUR 339

Cog3 sgRNA CRISPR Lentivector set (Rat)

K6148301 3 x 1.0 ug
EUR 339

COG3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0481002 1.0 ug DNA
EUR 154

COG3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0481003 1.0 ug DNA
EUR 154

COG3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0481004 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3568402 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3568403 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3568404 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6148302 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6148303 1.0 ug DNA
EUR 154

Cog3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6148304 1.0 ug DNA
EUR 154

COG3 Protein Vector (Mouse) (pPB-C-His)

PV166978 500 ng
EUR 1065

COG3 Protein Vector (Mouse) (pPB-N-His)

PV166979 500 ng
EUR 1065

COG3 Protein Vector (Mouse) (pPM-C-HA)

PV166980 500 ng
EUR 1065

COG3 Protein Vector (Mouse) (pPM-C-His)

PV166981 500 ng
EUR 1065

COG3 Protein Vector (Human) (pPB-C-His)

PV010105 500 ng
EUR 329

COG3 Protein Vector (Human) (pPB-N-His)

PV010106 500 ng
EUR 329

COG3 Protein Vector (Human) (pPM-C-HA)

PV010107 500 ng
EUR 329

COG3 Protein Vector (Human) (pPM-C-His)

PV010108 500 ng
EUR 329

COG3 Protein Vector (Rat) (pPB-C-His)

PV261002 500 ng
EUR 1166

COG3 Protein Vector (Rat) (pPB-N-His)

PV261003 500 ng
EUR 1166

COG3 Protein Vector (Rat) (pPM-C-HA)

PV261004 500 ng
EUR 1166

COG3 Protein Vector (Rat) (pPM-C-His)

PV261005 500 ng
EUR 1166

Cog3 3'UTR Luciferase Stable Cell Line

TU202595 1.0 ml Ask for price

Cog3 3'UTR GFP Stable Cell Line

TU154152 1.0 ml Ask for price

COG3 3'UTR Luciferase Stable Cell Line

TU004744 1.0 ml
EUR 1521

Cog3 3'UTR Luciferase Stable Cell Line

TU104152 1.0 ml Ask for price

COG3 3'UTR GFP Stable Cell Line

TU054744 1.0 ml
EUR 1521

Cog3 3'UTR GFP Stable Cell Line

TU252595 1.0 ml Ask for price

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

abx026276-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

abx026276-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody

abx231829-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Component of Oligomeric Golgi Complex 3 (COG3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


COPA antibody

70R-6205 50 ug
EUR 467
Description: Rabbit polyclonal COPA antibody raised against the middle region of COPA


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COPA Blocking Peptide

33R-4092 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COPA antibody, catalog no. 70R-6205

COPA Blocking Peptide

33R-7432 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COPA antibody, catalog no. 70R-6204

Anti-COPA antibody

STJ72424 100 µg
EUR 359


ELI-10340d 96 Tests
EUR 928

Mouse COPA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human COPA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

plenti-CMV-COPA Plasmid

PVTBAV53014 2 ug
EUR 356

Polyclonal COPA Antibody (internal region)

APR15549G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human COPA (internal region). This antibody is tested and proven to work in the following applications:

Copa ORF Vector (Rat) (pORF)

ORF065297 1.0 ug DNA
EUR 506

COPA ORF Vector (Human) (pORF)

ORF017609 1.0 ug DNA
EUR 405

Copa ORF Vector (Mouse) (pORF)

ORF041825 1.0 ug DNA
EUR 506

Polyclonal COPA antibody - N-terminal region

APR15550G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COPA - N-terminal region. This antibody is tested and proven to work in the following applications:

COPA sgRNA CRISPR Lentivector set (Human)

K0488401 3 x 1.0 ug
EUR 339

Copa sgRNA CRISPR Lentivector set (Rat)

K6621501 3 x 1.0 ug
EUR 339

Copa sgRNA CRISPR Lentivector set (Mouse)

K4357301 3 x 1.0 ug
EUR 339

Rat Coatomer subunit Alpha (COPA) ELISA kit

E02C1931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coatomer subunit Alpha (COPA) ELISA kit

E02C1931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coatomer subunit Alpha (COPA) ELISA kit

E02C1931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coatomer subunit Alpha (COPA) ELISA kit

E03C1931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coatomer subunit Alpha (COPA) ELISA kit

E03C1931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coatomer subunit Alpha (COPA) ELISA kit

E03C1931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coatomer subunit Alpha (COPA) ELISA kit

E06C1931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coatomer subunit Alpha (COPA) ELISA kit

E06C1931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coatomer subunit Alpha (COPA) ELISA kit

E06C1931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coatomer subunit Alpha (COPA) ELISA kit

E04C1931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coatomer subunit Alpha (COPA) ELISA kit

E04C1931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coatomer subunit Alpha (COPA) ELISA kit

E04C1931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coatomer subunit Alpha (COPA) ELISA kit

E01C1931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coatomer subunit Alpha (COPA) ELISA kit

E01C1931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coatomer subunit Alpha (COPA) ELISA kit

E01C1931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coatomer subunit Alpha (COPA) ELISA kit

E09C1931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coatomer subunit Alpha (COPA) ELISA kit

E09C1931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coatomer subunit Alpha (COPA) ELISA kit

E09C1931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coatomer subunit Alpha (COPA) ELISA kit

E08C1931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coatomer subunit Alpha (COPA) ELISA kit

E08C1931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coatomer subunit Alpha (COPA) ELISA kit

E08C1931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coatomer subunit Alpha (COPA) ELISA kit

E07C1931-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coatomer subunit Alpha (COPA) ELISA kit

E07C1931-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coatomer subunit Alpha (COPA) ELISA kit

E07C1931-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coatomer subunit Alpha (COPA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Copper-Exporting P-Type ATPase (COPA) Antibody

abx431180-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Bovine Coatomer subunit alpha, COPA ELISA KIT

ELI-46978b 96 Tests
EUR 928

Human Coatomer subunit alpha, COPA ELISA KIT

ELI-46979h 96 Tests
EUR 824

Mouse Coatomer subunit alpha, Copa ELISA KIT

ELI-46980m 96 Tests
EUR 865

COPA sgRNA CRISPR Lentivector (Human) (Target 1)

K0488402 1.0 ug DNA
EUR 154

COPA sgRNA CRISPR Lentivector (Human) (Target 2)

K0488403 1.0 ug DNA
EUR 154

COPA sgRNA CRISPR Lentivector (Human) (Target 3)

K0488404 1.0 ug DNA
EUR 154

Copa sgRNA CRISPR Lentivector (Rat) (Target 1)

K6621502 1.0 ug DNA
EUR 154

Copa sgRNA CRISPR Lentivector (Rat) (Target 2)

K6621503 1.0 ug DNA
EUR 154

Copa sgRNA CRISPR Lentivector (Rat) (Target 3)

K6621504 1.0 ug DNA
EUR 154

Copa sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4357302 1.0 ug DNA
EUR 154

Copa sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4357303 1.0 ug DNA
EUR 154

Copa sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4357304 1.0 ug DNA
EUR 154

COPA Protein Vector (Mouse) (pPB-C-His)

PV167298 500 ng
EUR 1065

COPA Protein Vector (Mouse) (pPB-N-His)

PV167299 500 ng
EUR 1065

COPA Protein Vector (Mouse) (pPM-C-HA)

PV167300 500 ng
EUR 1065

COPA Protein Vector (Mouse) (pPM-C-His)

PV167301 500 ng
EUR 1065

COPA Protein Vector (Rat) (pPB-C-His)

PV261186 500 ng
EUR 1191

COPA Protein Vector (Rat) (pPB-N-His)

PV261187 500 ng
EUR 1191

COPA Protein Vector (Rat) (pPM-C-HA)

PV261188 500 ng
EUR 1191

COPA Protein Vector (Rat) (pPM-C-His)

PV261189 500 ng
EUR 1191

COPA Protein Vector (Human) (pPB-C-His)

PV070433 500 ng
EUR 811

COPA Protein Vector (Human) (pPB-N-His)

PV070434 500 ng
EUR 811

COPA Protein Vector (Human) (pPM-C-HA)

PV070435 500 ng
EUR 811

COPA Protein Vector (Human) (pPM-C-His)

PV070436 500 ng
EUR 811

Copa 3'UTR GFP Stable Cell Line

TU154220 1.0 ml Ask for price

Copa 3'UTR Luciferase Stable Cell Line

TU104220 1.0 ml Ask for price

Copa 3'UTR Luciferase Stable Cell Line

TU202655 1.0 ml Ask for price



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COPE Antibody

39423-100ul 100ul
EUR 390

COPE antibody

31852-100ul 100ul
EUR 252

COPE antibody

31852-50ul 50ul
EUR 187

COPE antibody

70R-16510 50 ul
EUR 435
Description: Rabbit polyclonal COPE antibody

COPE Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against COPE. Recognizes COPE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

COPE Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COPE. Recognizes COPE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200


YF-PA17588 50 ul
EUR 363
Description: Mouse polyclonal to COPE


YF-PA25787 50 ul
EUR 334
Description: Mouse polyclonal to COPE

COPE cloning plasmid

CSB-CL005785HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 927
  • Sequence: atggcgcctccggcccccggcccggcctccggcggctccggggaggtagacgagctgttcgacgtaaagaacgccttctacatcggcagctaccagcagtgcataaacgaggcgcagcgggtgaagctgtcaagcccagagagagacgtggagagggacgtcttcctgtatagagc
  • Show more
Description: A cloning plasmid for the COPE gene.

anti- COPE antibody

FNab01865 100µg
EUR 505.25
  • Immunogen: coatomer protein complex, subunit epsilon
  • Uniprot ID: O14579
  • Gene ID: 11316
  • Research Area: Signal Transduction
Description: Antibody raised against COPE

COPE Polyclonal Antibody

A64056 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-COPE Antibody

A04544 100ug/vial
EUR 334

COPE Rabbit pAb

A10047-100ul 100 ul
EUR 308

COPE Rabbit pAb

A10047-200ul 200 ul
EUR 459

COPE Rabbit pAb

A10047-20ul 20 ul
EUR 183

COPE Rabbit pAb

A10047-50ul 50 ul
EUR 223

COPE Polyclonal Antibody

27272-100ul 100ul
EUR 252

COPE Polyclonal Antibody

27272-50ul 50ul
EUR 187

Anti-COPE antibody

PAab01865 100 ug
EUR 355

Anti-COPE antibody

STJ112087 100 µl
EUR 277
Description: The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified.

COPE Polyclonal Conjugated Antibody

C31852 100ul
EUR 397

COPE Polyclonal Conjugated Antibody

C27272 100ul
EUR 397

Mouse COPE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF008792 96 Tests
EUR 689

Human COPE shRNA Plasmid