SYVN1

SYVN1 antibody
70R-20682 50 ul
EUR 435
Description: Rabbit polyclonal SYVN1 antibody
SYVN1 Antibody
35945-100ul 100ul
EUR 252
SYVN1 Antibody
1-CSB-PA831487
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYVN1. Recognizes SYVN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
SYVN1 Antibody
1-CSB-PA803115LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYVN1. Recognizes SYVN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
SYVN1 Antibody
DF12235 200ul
EUR 304
Description: SYVN1 antibody detects endogenous levels of SYVN1.
SYVN1 antibody
70R-7259 50 ug
EUR 467
Description: Rabbit polyclonal SYVN1 antibody raised against the C terminal of SYVN1
SYVN1 Antibody
1-CSB-PA023051GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SYVN1. Recognizes SYVN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SYVN1 siRNA
20-abx935880
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SYVN1 siRNA
20-abx935881
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-SYVN1
YF-PA21407 100 ug
EUR 403
Description: Rabbit polyclonal to SYVN1
SYVN1 Blocking Peptide
33R-1484 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYVN1 antibody, catalog no. 70R-7259
SYVN1 Blocking Peptide
33R-7565 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYVN1 antibody, catalog no. 70R-1869
SYVN1 Blocking Peptide
DF12235-BP 1mg
EUR 195
SYVN1 Conjugated Antibody
C35945 100ul
EUR 397
SYVN1 cloning plasmid
CSB-CL803115HU-10ug 10ug
EUR 629
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1854
  • Sequence: atgttccgcacggcagtgatgatggcggccagcctggcgctgaccggggctgtggtggctcacgcctactacctcaaacaccagttctaccccactgtggtgtacctgaccaagtccagccccagcatggcagtcctgtacatccaggcctttgtccttgtcttccttctgggca
  • Show more
Description: A cloning plasmid for the SYVN1 gene.
SYVN1 Rabbit pAb
A2605-100ul 100 ul
EUR 308
SYVN1 Rabbit pAb
A2605-200ul 200 ul
EUR 459
SYVN1 Rabbit pAb
A2605-20ul 20 ul
EUR 183
SYVN1 Rabbit pAb
A2605-50ul 50 ul
EUR 223
anti- SYVN1 antibody
FNab08463 100µg
EUR 548.75
  • Immunogen: synovial apoptosis inhibitor 1, synoviolin
  • Uniprot ID: Q86TM6
  • Gene ID: 84447
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against SYVN1
Anti-SYVN1 antibody
PAab08463 100 ug
EUR 386
Anti-SYVN1 antibody
STJ25765 100 µl
EUR 277
Description: This gene encodes a protein involved in endoplasmic reticulum (ER)-associated degradation. The encoded protein removes unfolded proteins, accumulated during ER stress, by retrograde transport to the cytosol from the ER. This protein also uses the ubiquitin-proteasome system for additional degradation of unfolded proteins. Sequence analysis identified two transcript variants that encode different isoforms.
Anti-SYVN1 antibody
STJ72134 100 µg
EUR 359
Anti-SYVN1 antibody
STJ73118 100 µg
EUR 359
Anti-SYVN1 (4H4)
YF-MA19552 100 ug
EUR 363
Description: Mouse monoclonal to SYVN1
Anti-SYVN1 (4H4)
YF-MA20594 200 ul
EUR 363
Description: Mouse monoclonal to SYVN1
SYVN1 Antibody, HRP conjugated
1-CSB-PA803115LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYVN1. Recognizes SYVN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SYVN1 Antibody, FITC conjugated
1-CSB-PA803115LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYVN1. Recognizes SYVN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SYVN1 Antibody, Biotin conjugated
1-CSB-PA803115LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYVN1. Recognizes SYVN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SYVN1 ELISA KIT|Human
EF003422 96 Tests
EUR 689
Mouse SYVN1 shRNA Plasmid
20-abx978101
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SYVN1 shRNA Plasmid
20-abx963478
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SYVN1 Recombinant Protein (Rat)
RP232019 100 ug Ask for price
SYVN1 Recombinant Protein (Human)
RP030811 100 ug Ask for price
SYVN1 Recombinant Protein (Mouse)
RP176945 100 ug Ask for price
SYVN1 Recombinant Protein (Mouse)
RP176948 100 ug Ask for price
Polyclonal SYVN1 Antibody (internal region)
APG00638G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SYVN1 (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal SYVN1 / HRD1 Antibody (Internal)
APR02092G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYVN1 / HRD1 (Internal). This antibody is tested and proven to work in the following applications:
Syvn1 ORF Vector (Rat) (pORF)
ORF077341 1.0 ug DNA
EUR 506
SYVN1 ORF Vector (Human) (pORF)
ORF010271 1.0 ug DNA
EUR 95
Syvn1 ORF Vector (Mouse) (pORF)
ORF058983 1.0 ug DNA
EUR 506
Syvn1 ORF Vector (Mouse) (pORF)
ORF058984 1.0 ug DNA
EUR 506
SYVN1 ELISA Kit (Human) (OKCA01215)
OKCA01215 96 Wells
EUR 846
Description: Description of target: Acts as an E3 ubiquitin-protein ligase which accepts ubiquitin specifically from endoplasmic reticulum-associated UBC7 E2 ligase and transfers it to substrates, promoting their degradation. Component of the endoplasmic reticulum quality control (ERQC) system also called ER-associated degradation (ERAD) involved in ubiquitin-dependent degradation of misfolded endoplasmic reticulum proteins. Also promotes the degradation of normal but naturally short-lived proteins such as SGK. Protects cells from ER stress-induced apoptosis. Protects neurons from apoptosis induced by polyglutamine-expanded huntingtin (HTT) or unfolded GPR37 by promoting their degradation. Sequesters p53/TP53 in the cytoplasm and promotes its degradation, thereby negatively regulating its biological function in transcription, cell cycle regulation and apoptosis.1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 2.34 pg/mL
Polyclonal SYVN1 (HRD1) Antibody (C-term)
APR14266G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYVN1 (HRD1) (C-term). This antibody is tested and proven to work in the following applications:
Syvn1 sgRNA CRISPR Lentivector set (Rat)
K6311201 3 x 1.0 ug
EUR 339
Syvn1 sgRNA CRISPR Lentivector set (Mouse)
K3441101 3 x 1.0 ug
EUR 339
SYVN1 sgRNA CRISPR Lentivector set (Human)
K2324801 3 x 1.0 ug
EUR 339
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
abx025097-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
abx025097-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
abx025098-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
abx025098-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
E3 ubiquitin-protein ligase synoviolin (SYVN1) Antibody
20-abx211798
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
abx238463-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Polyclonal Goat Anti-SYVN1 Antibody (internal region)
APG00973G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-SYVN1 (internal region). This antibody is tested and proven to work in the following applications:
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
abx431931-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
abx431932-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
20-abx302155
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase Synoviolin (SYVN1) Antibody
20-abx002034
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Syvn1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6311202 1.0 ug DNA
EUR 154
Syvn1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6311203 1.0 ug DNA
EUR 154
Syvn1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6311204 1.0 ug DNA
EUR 154
Syvn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3441102 1.0 ug DNA
EUR 154
Syvn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3441103 1.0 ug DNA
EUR 154
Syvn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3441104 1.0 ug DNA
EUR 154
SYVN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2324802 1.0 ug DNA
EUR 154
SYVN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2324803 1.0 ug DNA
EUR 154
SYVN1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2324804 1.0 ug DNA
EUR 154
SYVN1 Protein Vector (Rat) (pPB-C-His)
PV309362 500 ng
EUR 603
SYVN1 Protein Vector (Rat) (pPB-N-His)
PV309363 500 ng
EUR 603
SYVN1 Protein Vector (Rat) (pPM-C-HA)
PV309364 500 ng
EUR 603
SYVN1 Protein Vector (Rat) (pPM-C-His)
PV309365 500 ng
EUR 603
SYVN1 Protein Vector (Human) (pPB-C-His)
PV041081 500 ng
EUR 329
SYVN1 Protein Vector (Human) (pPB-N-His)
PV041082 500 ng
EUR 329
SYVN1 Protein Vector (Human) (pPM-C-HA)
PV041083 500 ng
EUR 329
SYVN1 Protein Vector (Human) (pPM-C-His)
PV041084 500 ng
EUR 329