DHPS

80  

DHPS antibody
38852-100ul 100ul
EUR 252

DHPS antibody
10R-3834 100 ul
EUR 726
Description: Mouse monoclonal DHPS antibody

DHPS Antibody
1-CSB-PA002145
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

DHPS Antibody
DF3987 200ul
EUR 304
Description: DHPS Antibody detects endogenous levels of total DHPS.

DHPS Antibody
1-CSB-PA006854LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DHPS antibody
70R-35966 100 ug
EUR 327
Description: Rabbit polyclonal DHPS antibody

DHPS antibody
70R-49659 100 ul
EUR 244
Description: Purified Polyclonal DHPS antibody

DHPS siRNA
20-abx901487
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DHPS siRNA
20-abx914093
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DHPS siRNA
20-abx914094
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DHPS Antibody
ABD13069 100 ug
EUR 438

DHPS Antibody
ABD3987 100 ug
EUR 438

anti-DHPS
YF-PA11350 50 ul
EUR 363
Description: Mouse polyclonal to DHPS

anti-DHPS
YF-PA11351 50 ug
EUR 363
Description: Mouse polyclonal to DHPS

Human DHPS Antibody
33066-05111 150 ug
EUR 261

DHPS Blocking Peptide
DF3987-BP 1mg
EUR 195

DHPS Blocking Peptide
20-abx062534
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

DHPS Conjugated Antibody
C38852 100ul
EUR 397

DHPS cloning plasmid
CSB-CL006854HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atggaaggttccctggaacgggaggcgccagcgggggcgctggccgccgtgctaaagcacagctcgacgttgccgcccgaaagcacccaggtccggggctacgacttcaaccgcggtgtgaattaccgcgcactgctggaggccttcggcaccaccggcttccaagcaaccaact
  • Show more
Description: A cloning plasmid for the DHPS gene.

DHPS cloning plasmid
CSB-CL006854HU2-10ug 10ug
EUR 420
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atggaaggttccctggaacgggaggcgccagcgggggcgctggccgccgtgctaaagcacagctcgacgttgccgcccgaaagcacccaggtccggggctacgacttcaaccgcggtgtgaattaccgcgcactgctggaggccttcggcaccaccggcttccaagcaaccaact
  • Show more
Description: A cloning plasmid for the DHPS gene.

DHPS Rabbit pAb
A6367-100ul 100 ul
EUR 308

DHPS Rabbit pAb
A6367-200ul 200 ul
EUR 459

DHPS Rabbit pAb
A6367-20ul 20 ul
EUR 183

DHPS Rabbit pAb
A6367-50ul 50 ul
EUR 223

anti- DHPS antibody
FNab02368 100µg
EUR 505.25
  • Immunogen: deoxyhypusine synthase
  • Uniprot ID: P49366
  • Gene ID: 1725
  • Research Area: Metabolism
Description: Antibody raised against DHPS

Anti-DHPS antibody
PAab02368 100 ug
EUR 355

Anti-DHPS antibody
STJ28450 100 µl
EUR 277
Description: This gene encodes a protein that is required for the formation of hypusine, a unique amino acid formed by the posttranslational modification of only one protein, eukaryotic translation initiation factor 5A. The encoded protein catalyzes the first step in hypusine formation by transferring the butylamine moiety of spermidine to a specific lysine residue of the eukaryotic translation initiation factor 5A precursor, forming an intermediate deoxyhypusine residue. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

DHPS Antibody, HRP conjugated
1-CSB-PA006854LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DHPS Antibody, FITC conjugated
1-CSB-PA006854LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DHPS Antibody, Biotin conjugated
1-CSB-PA006854LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DHPS protein (His tag)
80R-1271 100 ug
EUR 268
Description: Purified recombinant Human DHPS protein

Deoxyhypusine Synthase (DHPS) Antibody
20-abx009336
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx004867
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx119594
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx131328
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx131329
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Deoxyhypusine Synthase (DHPS) Antibody
abx029248-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
abx029248-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rat DHPS shRNA Plasmid
20-abx988357
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx323696
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx333996
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
abx232368-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mouse DHPS shRNA Plasmid
20-abx983635
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DHPS shRNA Plasmid
20-abx951195
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-DHPS/Dhs Antibody
A30637 100ul
EUR 397
Description: Rabbit Polyclonal DHPS/Dhs Antibody. Validated in WB and tested in Human.

Recombinant Deoxyhypusine Synthase (DHPS)
4-RPC900Hu01
  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49366
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Deoxyhypusine Synthase expressed in: E.coli

Recombinant Deoxyhypusine Synthase (DHPS)
4-RPC900Mu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3TXU5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Deoxyhypusine Synthase expressed in: E.coli

DHPS Recombinant Protein (Human)
RP009247 100 ug Ask for price

DHPS Recombinant Protein (Human)
RP009250 100 ug Ask for price

DHPS Recombinant Protein (Rat)
RP197978 100 ug Ask for price

DHPS Recombinant Protein (Mouse)
RP128924 100 ug Ask for price

Human DHPS Antibody (Biotin Conjugate)
33066-05121 150 ug
EUR 369

Polyclonal DHPS Antibody (aa51-100)
APR03327G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS (aa51-100). This antibody is tested and proven to work in the following applications:

Polyclonal DHPS Antibody (N-term)
APR04168G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS (N-term). This antibody is tested and proven to work in the following applications:

Deoxyhypusine Synthase (DHPS) Antibody (HRP)
20-abx335304
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody (FITC)
20-abx335305
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody (Biotin)
20-abx335306
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Deoxyhypusine Synthase (DHPS) Protein
20-abx650234
  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Deoxyhypusine Synthase (DHPS) Protein
20-abx650235
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dhps ORF Vector (Rat) (pORF)
ORF065994 1.0 ug DNA
EUR 506

DHPS ORF Vector (Human) (pORF)
ORF003083 1.0 ug DNA
EUR 95

DHPS ORF Vector (Human) (pORF)
ORF003084 1.0 ug DNA
EUR 95

Dhps ORF Vector (Mouse) (pORF)
ORF042976 1.0 ug DNA
EUR 506

DHPS ELISA Kit (Human) (OKWB00169)
OKWB00169 96 Wells
EUR 572
Description: Description of target: Catalyzes the NAD-dependent oxidative cleavage of spermidine and the subsequent transfer of the butylamine moiety of spermidine to the epsilon-amino group of a specific lysine residue of the eIF-5A precursor protein to form the intermediate deoxyhypusine residue. ;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Human DHPS AssayLite Antibody (FITC Conjugate)
33066-05141 150 ug
EUR 428

Human DHPS AssayLite Antibody (RPE Conjugate)
33066-05151 150 ug
EUR 428

Human DHPS AssayLite Antibody (APC Conjugate)
33066-05161 150 ug
EUR 428

Human DHPS AssayLite Antibody (PerCP Conjugate)
33066-05171 150 ug
EUR 471

Polyclonal DHPS antibody - N-terminal region
APR01465G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS - N-terminal region. This antibody is tested and proven to work in the following applications:

Human Deoxyhypusine synthase, DHPS ELISA KIT
ELI-08955h 96 Tests
EUR 824