KCNA6 Antibody
1-CSB-PA012011LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNA6. Recognizes KCNA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KCNA6 siRNA
20-abx921160	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KCNA6 siRNA
20-abx921161	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KCNA6 Antibody (HRP)
20-abx304269	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

KCNA6 Antibody (FITC)
20-abx304270	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

KCNA6 Antibody (Biotin)
20-abx304271	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

KCNA6 cloning plasmid
CSB-CL012011HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1590 Sequence: atgagatcggagaaatcccttacgctggcggcgccgggggaggtccgtgggccggagggagagcaacaggatgcgggagacttcccggaggccggcgggggcgggggctgctgtagtagcgagcggctggtgatcaatatctccgggctgcgctttgagacacaattgcgcaccc Show more
Description: A cloning plasmid for the KCNA6 gene.

KCNA6 Polyclonal Antibody
A62810	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

KCNA6 Polyclonal Antibody
ABP59012-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500 Applications tips:
Description: A polyclonal antibody for detection of KCNA6 from Human, Mouse, Rat. This KCNA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500

KCNA6 Polyclonal Antibody
ABP59012-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500 Applications tips:
Description: A polyclonal antibody for detection of KCNA6 from Human, Mouse, Rat. This KCNA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500

KCNA6 Polyclonal Antibody
ABP59012-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500 Applications tips:
Description: A polyclonal antibody for detection of KCNA6 from Human, Mouse, Rat. This KCNA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500

KCNA6 Polyclonal Antibody
ES10023-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against KCNA6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

KCNA6 Polyclonal Antibody
ES10023-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against KCNA6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-KCNA6 antibody
STJ191181	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to KCNA6

KCNA6 Antibody, HRP conjugated
1-CSB-PA012011LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNA6. Recognizes KCNA6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KCNA6 Antibody, FITC conjugated
1-CSB-PA012011LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNA6. Recognizes KCNA6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KCNA6 Antibody, Biotin conjugated
1-CSB-PA012011LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNA6. Recognizes KCNA6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human KCNA6 shRNA Plasmid
20-abx952518	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse KCNA6 shRNA Plasmid
20-abx971136	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human KCNA6 ELISA KIT
ELI-37154h	Lifescience Market	96 Tests	EUR 824

Mouse Kcna6 ELISA KIT
ELI-37155m	Lifescience Market	96 Tests	EUR 865

Anti-Kv1.6/KCNA6 Antibody
PA2271	BosterBio	100ug/vial	EUR 294

KCNA6 Recombinant Protein (Human)
RP016570	ABM	100 ug	Ask for price

KCNA6 Recombinant Protein (Rat)
RP206702	ABM	100 ug	Ask for price

KCNA6 Recombinant Protein (Mouse)
RP144929	ABM	100 ug	Ask for price

KCNA6 Polyclonal Antibody, HRP Conjugated
A62811	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

KCNA6 Polyclonal Antibody, FITC Conjugated
A62812	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

KCNA6 Polyclonal Antibody, Biotin Conjugated
A62813	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Kcna6 ORF Vector (Rat) (pORF)
ORF068902	ABM	1.0 ug DNA	EUR 506

KCNA6 ORF Vector (Human) (pORF)
ORF005524	ABM	1.0 ug DNA	EUR 95

Kcna6 ORF Vector (Mouse) (pORF)
ORF048311	ABM	1.0 ug DNA	EUR 506

Kcna6 sgRNA CRISPR Lentivector set (Rat)
K7062701	ABM	3 x 1.0 ug	EUR 339

Kcna6 sgRNA CRISPR Lentivector set (Mouse)
K3403001	ABM	3 x 1.0 ug	EUR 339

KCNA6 sgRNA CRISPR Lentivector set (Human)
K1116801	ABM	3 x 1.0 ug	EUR 339

Kcna6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7062702	ABM	1.0 ug DNA	EUR 154

Kcna6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7062703	ABM	1.0 ug DNA	EUR 154

Kcna6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7062704	ABM	1.0 ug DNA	EUR 154

Kcna6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3403002	ABM	1.0 ug DNA	EUR 154

Kcna6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3403003	ABM	1.0 ug DNA	EUR 154

Kcna6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3403004	ABM	1.0 ug DNA	EUR 154

KCNA6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1116802	ABM	1.0 ug DNA	EUR 154

KCNA6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1116803	ABM	1.0 ug DNA	EUR 154

KCNA6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1116804	ABM	1.0 ug DNA	EUR 154

KCNA6 Protein Vector (Human) (pPB-C-His)
PV022093	ABM	500 ng	EUR 329

KCNA6 Protein Vector (Human) (pPB-N-His)
PV022094	ABM	500 ng	EUR 329

KCNA6 Protein Vector (Human) (pPM-C-HA)
PV022095	ABM	500 ng	EUR 329

KCNA6 Protein Vector (Human) (pPM-C-His)
PV022096	ABM	500 ng	EUR 329

KCNA6 Protein Vector (Rat) (pPB-C-His)
PV275606	ABM	500 ng	EUR 603

KCNA6 Protein Vector (Rat) (pPB-N-His)
PV275607	ABM	500 ng	EUR 603

KCNA6 Protein Vector (Rat) (pPM-C-HA)
PV275608	ABM	500 ng	EUR 603

KCNA6 Protein Vector (Rat) (pPM-C-His)
PV275609	ABM	500 ng	EUR 603

KCNA6 Protein Vector (Mouse) (pPB-C-His)
PV193242	ABM	500 ng	EUR 603

KCNA6 Protein Vector (Mouse) (pPB-N-His)
PV193243	ABM	500 ng	EUR 603

KCNA6 Protein Vector (Mouse) (pPM-C-HA)
PV193244	ABM	500 ng	EUR 603

KCNA6 Protein Vector (Mouse) (pPM-C-His)
PV193245	ABM	500 ng	EUR 603

Kcna6 3'UTR Luciferase Stable Cell Line
TU110395	ABM	1.0 ml	Ask for price

Kcna6 3'UTR GFP Stable Cell Line
TU160395	ABM	1.0 ml	Ask for price

Kcna6 3'UTR Luciferase Stable Cell Line
TU206540	ABM	1.0 ml	Ask for price

Kcna6 3'UTR GFP Stable Cell Line
TU256540	ABM	1.0 ml	Ask for price

KCNA6 3'UTR GFP Stable Cell Line
TU061461	ABM	1.0 ml	EUR 2333

KCNA6 3'UTR Luciferase Stable Cell Line
TU011461	ABM	1.0 ml	EUR 2333

KCNA6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV668305	ABM	1.0 ug DNA	EUR 682

KCNA6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV668309	ABM	1.0 ug DNA	EUR 682

KCNA6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV668310	ABM	1.0 ug DNA	EUR 682

Potassium Voltage-Gated Channel Subfamily A Member 6 (KCNA6) Antibody
abx029343-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily A Member 6 (KCNA6) Antibody
abx029343-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily A Member 6 (KCNA6) Antibody
20-abx304268	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7062705	ABM	3 x 1.0 ug	EUR 376

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3403005	ABM	3 x 1.0 ug	EUR 376

KCNA6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1116805	ABM	3 x 1.0 ug	EUR 376

KCNA6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV668306	ABM	1.0 ug DNA	EUR 682

KCNA6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV668307	ABM	1.0 ug DNA	EUR 740

KCNA6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV668308	ABM	1.0 ug DNA	EUR 740

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7062706	ABM	1.0 ug DNA	EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7062707	ABM	1.0 ug DNA	EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7062708	ABM	1.0 ug DNA	EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3403006	ABM	1.0 ug DNA	EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3403007	ABM	1.0 ug DNA	EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3403008	ABM	1.0 ug DNA	EUR 167

KCNA6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1116806	ABM	1.0 ug DNA	EUR 167

KCNA6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1116807	ABM	1.0 ug DNA	EUR 167

KCNA6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1116808	ABM	1.0 ug DNA	EUR 167