  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KCNA6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNA6. Recognizes KCNA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KCNA6 cloning plasmid

CSB-CL012011HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1590
  • Sequence: atgagatcggagaaatcccttacgctggcggcgccgggggaggtccgtgggccggagggagagcaacaggatgcgggagacttcccggaggccggcgggggcgggggctgctgtagtagcgagcggctggtgatcaatatctccgggctgcgctttgagacacaattgcgcaccc
  • Show more
Description: A cloning plasmid for the KCNA6 gene.

KCNA6 Polyclonal Antibody

ES10023-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KCNA6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

KCNA6 Polyclonal Antibody

ES10023-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KCNA6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

KCNA6 Polyclonal Antibody

ABP59012-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of KCNA6 from Human, Mouse, Rat. This KCNA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500

KCNA6 Polyclonal Antibody

ABP59012-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of KCNA6 from Human, Mouse, Rat. This KCNA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500

KCNA6 Polyclonal Antibody

ABP59012-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of KCNA6 from Human, Mouse, Rat. This KCNA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNA6 protein at amino acid sequence of 420-500

KCNA6 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

KCNA6 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

KCNA6 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

KCNA6 Polyclonal Antibody

A62810 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-KCNA6 antibody

STJ191181 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KCNA6


ELI-37154h 96 Tests
EUR 824

Mouse Kcna6 ELISA KIT

ELI-37155m 96 Tests
EUR 865

Mouse KCNA6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KCNA6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KCNA6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNA6. Recognizes KCNA6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KCNA6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNA6. Recognizes KCNA6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KCNA6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNA6. Recognizes KCNA6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Kv1.6/KCNA6 Antibody

PA2271 100ug/vial
EUR 294

KCNA6 Recombinant Protein (Human)

RP016570 100 ug Ask for price

KCNA6 Recombinant Protein (Rat)

RP206702 100 ug Ask for price

KCNA6 Recombinant Protein (Mouse)

RP144929 100 ug Ask for price

KCNA6 Polyclonal Antibody, HRP Conjugated

A62811 100 µg
EUR 570.55
Description: kits suitable for this type of research

KCNA6 Polyclonal Antibody, FITC Conjugated

A62812 100 µg
EUR 570.55
Description: fast delivery possible

KCNA6 Polyclonal Antibody, Biotin Conjugated

A62813 100 µg
EUR 570.55
Description: reagents widely cited

KCNA6 ORF Vector (Human) (pORF)

ORF005524 1.0 ug DNA
EUR 95

Kcna6 ORF Vector (Rat) (pORF)

ORF068902 1.0 ug DNA
EUR 506

Kcna6 ORF Vector (Mouse) (pORF)

ORF048311 1.0 ug DNA
EUR 506

KCNA6 sgRNA CRISPR Lentivector set (Human)

K1116801 3 x 1.0 ug
EUR 339

Kcna6 sgRNA CRISPR Lentivector set (Mouse)

K3403001 3 x 1.0 ug
EUR 339

Kcna6 sgRNA CRISPR Lentivector set (Rat)

K7062701 3 x 1.0 ug
EUR 339

KCNA6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1116802 1.0 ug DNA
EUR 154

KCNA6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1116803 1.0 ug DNA
EUR 154

KCNA6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1116804 1.0 ug DNA
EUR 154

Kcna6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3403002 1.0 ug DNA
EUR 154

Kcna6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3403003 1.0 ug DNA
EUR 154

Kcna6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3403004 1.0 ug DNA
EUR 154

Kcna6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7062702 1.0 ug DNA
EUR 154

Kcna6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7062703 1.0 ug DNA
EUR 154

Kcna6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7062704 1.0 ug DNA
EUR 154

KCNA6 Protein Vector (Human) (pPB-C-His)

PV022093 500 ng
EUR 329

KCNA6 Protein Vector (Human) (pPB-N-His)

PV022094 500 ng
EUR 329

KCNA6 Protein Vector (Human) (pPM-C-HA)

PV022095 500 ng
EUR 329

KCNA6 Protein Vector (Human) (pPM-C-His)

PV022096 500 ng
EUR 329

KCNA6 Protein Vector (Rat) (pPB-C-His)

PV275606 500 ng
EUR 603

KCNA6 Protein Vector (Rat) (pPB-N-His)

PV275607 500 ng
EUR 603

KCNA6 Protein Vector (Rat) (pPM-C-HA)

PV275608 500 ng
EUR 603

KCNA6 Protein Vector (Rat) (pPM-C-His)

PV275609 500 ng
EUR 603

KCNA6 Protein Vector (Mouse) (pPB-C-His)

PV193242 500 ng
EUR 603

KCNA6 Protein Vector (Mouse) (pPB-N-His)

PV193243 500 ng
EUR 603

KCNA6 Protein Vector (Mouse) (pPM-C-HA)

PV193244 500 ng
EUR 603

KCNA6 Protein Vector (Mouse) (pPM-C-His)

PV193245 500 ng
EUR 603

Kcna6 3'UTR Luciferase Stable Cell Line

TU206540 1.0 ml Ask for price

Kcna6 3'UTR GFP Stable Cell Line

TU160395 1.0 ml Ask for price

KCNA6 3'UTR Luciferase Stable Cell Line

TU011461 1.0 ml
EUR 2333

Kcna6 3'UTR Luciferase Stable Cell Line

TU110395 1.0 ml Ask for price

KCNA6 3'UTR GFP Stable Cell Line

TU061461 1.0 ml
EUR 2333

Kcna6 3'UTR GFP Stable Cell Line

TU256540 1.0 ml Ask for price

KCNA6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV668305 1.0 ug DNA
EUR 682

KCNA6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV668309 1.0 ug DNA
EUR 682

KCNA6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV668310 1.0 ug DNA
EUR 682

Potassium Voltage-Gated Channel Subfamily A Member 6 (KCNA6) Antibody

abx029343-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily A Member 6 (KCNA6) Antibody

abx029343-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily A Member 6 (KCNA6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

KCNA6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1116805 3 x 1.0 ug
EUR 376

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3403005 3 x 1.0 ug
EUR 376

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7062705 3 x 1.0 ug
EUR 376

KCNA6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1116806 1.0 ug DNA
EUR 167

KCNA6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1116807 1.0 ug DNA
EUR 167

KCNA6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1116808 1.0 ug DNA
EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3403006 1.0 ug DNA
EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3403007 1.0 ug DNA
EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3403008 1.0 ug DNA
EUR 167

KCNA6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV668306 1.0 ug DNA
EUR 682

KCNA6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV668307 1.0 ug DNA
EUR 740

KCNA6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV668308 1.0 ug DNA
EUR 740

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7062706 1.0 ug DNA
EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7062707 1.0 ug DNA
EUR 167

Kcna6 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7062708 1.0 ug DNA
EUR 167