Uba2 Antibody
ABF0287 100 ug
EUR 438
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBA2 antibody
70R-50767 100 ul
EUR 244
Description: Purified Polyclonal UBA2 antibody
UBA2 antibody
70R-21085 50 ul
EUR 435
Description: Rabbit polyclonal UBA2 antibody
UBA2 antibody
70R-30824 100 ug
EUR 327
Description: Rabbit polyclonal UBA2 antibody
Uba2 Antibody
ABD13303 100 ug
EUR 438
Uba2 Antibody
33535-100ul 100ul
EUR 252
Uba2 Antibody
33535-50ul 50ul
EUR 187
UBA2 antibody
10R-6200 100 ul
EUR 726
Description: Mouse monoclonal UBA2 antibody
UBA2 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBA2. Recognizes UBA2 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
UBA2 Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UBA2. Recognizes UBA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
UBA2 Antibody
CSB-PA096056-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UBA2. Recognizes UBA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
UBA2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBA2. Recognizes UBA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Polyclonal Uba2 Antibody
APR05380G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Uba2 . This antibody is tested and proven to work in the following applications:
Uba2 Conjugated Antibody
C33535 100ul
EUR 397
Uba2 Blocking Peptide
AF0287-BP 1mg
EUR 195
anti- UBA2 antibody
FNab09143 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • Immunogen: ubiquitin-like modifier activating enzyme 2
  • Uniprot ID: Q9UBT2
  • Gene ID: 10054
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBA2
UBA2 Polyclonal Antibody
ES3661-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UBA2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
UBA2 Polyclonal Antibody
ES3661-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBA2 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
UBA2 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
UBA2 Polyclonal Antibody
ABP52662-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
  • Applications tips:
Description: A polyclonal antibody for detection of UBA2 from Human. This UBA2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
UBA2 Polyclonal Antibody
ABP52662-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
  • Applications tips:
Description: A polyclonal antibody for detection of UBA2 from Human. This UBA2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
UBA2 Polyclonal Antibody
ABP52662-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
  • Applications tips:
Description: A polyclonal antibody for detection of UBA2 from Human. This UBA2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human UBA2 at AA range: 560-640
UBA2 Rabbit pAb
A4363-100ul 100 ul
EUR 308
UBA2 Rabbit pAb
A4363-200ul 200 ul
EUR 459
UBA2 Rabbit pAb
A4363-20ul 20 ul Ask for price
UBA2 Rabbit pAb
A4363-50ul 50 ul Ask for price
UBA2 Rabbit pAb
A17342-100ul 100 ul
EUR 308
UBA2 Rabbit pAb
A17342-200ul 200 ul
EUR 459
UBA2 Rabbit pAb
A17342-20ul 20 ul
EUR 183
UBA2 Rabbit pAb
A17342-50ul 50 ul
EUR 223
SAE2/ UBA2 Antibody
49664-100ul 100ul
EUR 333
SAE2/ UBA2 Antibody
49664-50ul 50ul
EUR 239
UBA2 cloning plasmid
CSB-CL890664HU-10ug 10ug
EUR 649
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1923
  • Sequence: atggcactgtcgcgggggctgccccgggagctggctgaggcggtggccgggggccgggtgctggtggtgggggcgggcggcatcggctgcgagctcctcaagaatctcgtgctcaccggtttctcccacatcgacctgattgatctggatactattgatgtaagcaacctcaaca
  • Show more
Description: A cloning plasmid for the UBA2 gene.
Anti-UBA2 antibody
PAab09143 100 ug
EUR 412
Anti-UBA2 antibody
STJ96159 200 µl
EUR 197
Description: Rabbit polyclonal to UBA2.
Anti-UBA2 antibody
STJ26007 100 µl
EUR 277
Anti-UBA2 antibody
STJ119468 100 µl
EUR 277
anti-SAE2 / UBA2
YF-PA16681 50 ug
EUR 363
Description: Mouse polyclonal to SAE2 / UBA2
SAE2/ UBA2 Conjugated Antibody
C49664 100ul
EUR 397
Mouse UBA2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF003978 96 Tests
EUR 689
Human UBA2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-Uba2/Sae2 Antibody
A03816 100ul
EUR 397
Description: Rabbit Polyclonal Uba2/Sae2 Antibody. Validated in IHC, WB and tested in Human.
Anti-SAE2/UBA2 Antibody
A03816-2 100ug/vial
EUR 334
UBA2 Recombinant Protein (Human)
RP033625 100 ug Ask for price
UBA2 Recombinant Protein (Rat)
RP235472 100 ug Ask for price
UBA2 Recombinant Protein (Mouse)
RP182540 100 ug Ask for price
Anti-SAE2 / UBA2 antibody
STJ70427 100 µg
EUR 359
Anti-SAE2 / UBA2 Monoclonal Antibody
M03816 100ug
EUR 397
Description: Rabbit Monoclonal SAE2 / UBA2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Uba2 ORF Vector (Rat) (pORF)
ORF078492 1.0 ug DNA
EUR 506
UBA2 ORF Vector (Human) (pORF)
ORF011209 1.0 ug DNA
EUR 95
Uba2 ORF Vector (Mouse) (pORF)
ORF060848 1.0 ug DNA
EUR 506
Polyclonal SAE2 / UBA2 Antibody (aa160-210)
APR02482G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE2 / UBA2 (aa160-210). This antibody is tested and proven to work in the following applications:
Polyclonal SAE2 / UBA2 Antibody (C-Terminus)
APR02733G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE2 / UBA2 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal SAE2 / UBA2 Antibody (aa591-640)
APR02942G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE2 / UBA2 (aa591-640). This antibody is tested and proven to work in the following applications:
Polyclonal SAE2 / UBA2 Antibody (N-Term)
APG00424G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SAE2 / UBA2 (N-Term). This antibody is tested and proven to work in the following applications:
Uba2 Colorimetric Cell-Based ELISA Kit
EKC1584 100ul
EUR 572
UBA2 sgRNA CRISPR Lentivector set (Human)
K2567301 3 x 1.0 ug
EUR 339
Uba2 sgRNA CRISPR Lentivector set (Rat)
K6129201 3 x 1.0 ug
EUR 339
Uba2 sgRNA CRISPR Lentivector set (Mouse)
K4894501 3 x 1.0 ug
EUR 339
Anti-SAE2/UBA2 Antibody (monoclonal, 5H11)
M03816-1 100ug/vial
EUR 294
Anti-SAE2/UBA2 Antibody (monoclonal, 5B13)
M03816-2 100ug/vial
EUR 334
Polyclonal SAE2 (UBA2) Antibody (C-term E616)
APR03461G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAE2 (UBA2) (C-term E616). This antibody is tested and proven to work in the following applications:
UBA2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2567302 1.0 ug DNA
EUR 154
UBA2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2567303 1.0 ug DNA
EUR 154
UBA2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2567304 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6129202 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6129203 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6129204 1.0 ug DNA
EUR 154
Human SUMO-activating enzyme subunit 2 (UBA2)
  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 84.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human SUMO-activating enzyme subunit 2(UBA2) expressed in E.coli
Uba2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4894502 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4894503 1.0 ug DNA
EUR 154
Uba2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4894504 1.0 ug DNA
EUR 154


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP2 antibody
70R-21197 50 ul
EUR 435
Description: Rabbit polyclonal USP2 antibody
USP2 antibody
70R-9737 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP2 antibody
USP2 antibody
70R-9738 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP2 antibody
USP2 Antibody
36169-100ul 100ul
EUR 252
USP2 antibody
20R-UR010 50 ug
EUR 656
Description: Rabbit polyclonal USP2 antibody
USP2 Antibody
EUR 414
USP2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
USP2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
USP2 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
USP2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
USP2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200
YF-PA16086 50 ug
EUR 363
Description: Mouse polyclonal to USP2
YF-PA16087 100 ul
EUR 403
Description: Rabbit polyclonal to USP2
YF-PA16088 100 ug
EUR 403
Description: Rabbit polyclonal to USP2
Polyclonal USP2 Antibody
APR00330G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 . This antibody is tested and proven to work in the following applications:
USP2 Conjugated Antibody
C36169 100ul
EUR 397
USP2 cloning plasmid
CSB-CL025710HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1818
  • Sequence: atgtcccagctctcctccaccctgaagcgctacacagaatcggcccgctacacagatgcccactatgccaagtcgggctatggtgcctacaccccatcctcctatggggccaatctggctgcctccttactggagaaggagaaacttggtttcaagccggtccccaccagcagct
  • Show more
Description: A cloning plasmid for the USP2 gene.
anti- USP2 antibody
FNab09315 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200;IF:1:10-1:100
  • Immunogen: ubiquitin specific peptidase 2
  • Uniprot ID: O75604
  • Gene ID: 10869
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP2
anti- USP2 antibody
FNab09316 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • IF:1:10-1:100
  • Immunogen: ubiquitin specific peptidase 2
  • Uniprot ID: O75604
  • Gene ID: 10869
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP2
USP2 Rabbit pAb
A10399-100ul 100 ul
EUR 308
USP2 Rabbit pAb
A10399-200ul 200 ul
EUR 459
USP2 Rabbit pAb
A10399-20ul 20 ul
EUR 183
USP2 Rabbit pAb
A10399-50ul 50 ul
EUR 223
USP2 Rabbit pAb
A1433-100ul 100 ul
EUR 308
USP2 Rabbit pAb
A1433-200ul 200 ul
EUR 459
USP2 Rabbit pAb
A1433-20ul 20 ul Ask for price
USP2 Rabbit pAb
A1433-50ul 50 ul Ask for price
USP2 Blocking Peptide
33R-5126 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP2 antibody, catalog no. 70R-9738
USP2 Blocking Peptide
33R-6679 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP2 antibody, catalog no. 70R-9737
Anti-USP2 antibody
PAab09316 100 ug
EUR 386
Anti-USP2 antibody
STJ26059 100 µl
EUR 277
Description: This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.
Anti-USP2 antibody
STJ112435 100 µl
EUR 277
Description: This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.
Anti-USP2 Antibody
A2146-100 100 µg
EUR 389
Polyclonal USP2 Antibody (Internal)
APR02108G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (Internal). This antibody is tested and proven to work in the following applications:
Mouse USP2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat USP2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF004123 96 Tests
EUR 689
Human USP2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP2. Recognizes USP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
USP2 Recombinant Protein (Human)
RP034093 100 ug Ask for price
USP2 Recombinant Protein (Rat)
RP236057 100 ug Ask for price
USP2 Recombinant Protein (Mouse)
RP183365 100 ug Ask for price
USP2 Recombinant Protein (Mouse)
RP183368 100 ug Ask for price
USP2 Recombinant Protein (Mouse)
RP183371 100 ug Ask for price
Polyclonal USP2 Antibody (N-term)
APR04803G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal USP2 Antibody (C-term)
APR04804G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal USP2 Antibody (Ctr S260)
APR04806G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (Ctr S260). This antibody is tested and proven to work in the following applications:
Monoclonal USP2 Antibody, Clone: 1738CT331.50.87
AMM02572G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human USP2. The antibodies are raised in Mouse and are from clone 1738CT331.50.87. This antibody is applicable in WB, E
Usp2 ORF Vector (Rat) (pORF)
ORF078687 1.0 ug DNA
EUR 506
USP2 ORF Vector (Human) (pORF)
ORF011365 1.0 ug DNA
EUR 95
Usp2 ORF Vector (Mouse) (pORF)
ORF061123 1.0 ug DNA
EUR 506
Usp2 ORF Vector (Mouse) (pORF)
ORF061124 1.0 ug DNA
EUR 506
Usp2 ORF Vector (Mouse) (pORF)
ORF061125 1.0 ug DNA
EUR 506
pECMV-Usp2-m-FLAG Plasmid
PVT15133 2 ug
EUR 325
Polyclonal USP2 Antibody (C-term L523)
APR04805G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP2 (C-term L523). This antibody is tested and proven to work in the following applications:
Ubiquitin Specific Peptidase 2 (USP2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
USP2 sgRNA CRISPR Lentivector set (Human)
K2596001 3 x 1.0 ug
EUR 339
Usp2 sgRNA CRISPR Lentivector set (Mouse)
K3444501 3 x 1.0 ug
EUR 339
Usp2 sgRNA CRISPR Lentivector set (Rat)
K7088701 3 x 1.0 ug
EUR 339
Recombinant Ubiquitin Specific Peptidase 2 (USP2)
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O75604
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.4kDa
  • Isoelectric Point: 9.4
Description: Recombinant Human Ubiquitin Specific Peptidase 2 expressed in: E.coli
Recombinant Ubiquitin Specific Peptidase 2 (USP2)
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88623
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.1kDa
  • Isoelectric Point: 9.7
Description: Recombinant Mouse Ubiquitin Specific Peptidase 2 expressed in: E.coli
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031538-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031538-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031539-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031539-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031540-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
abx031540-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 2 (USP2) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


USP4 antibody
20R-UR008 50 ug
EUR 656
Description: Rabbit polyclonal USP4 antibody
USP4 antibody
20R-UR009 50 ug
EUR 656
Description: Rabbit polyclonal USP4 antibody
USP4 Antibody
EUR 207
USP4 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:50-1:200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP4 Polyclonal Antibody
27659-100ul 100ul
EUR 252
USP4 Polyclonal Antibody
27659-50ul 50ul
EUR 187
USP4 Rabbit pAb
A12242-100ul 100 ul
EUR 308
USP4 Rabbit pAb
A12242-200ul 200 ul
EUR 459
USP4 Rabbit pAb
A12242-20ul 20 ul
EUR 183
USP4 Rabbit pAb
A12242-50ul 50 ul
EUR 223
Polyclonal USP4 Antibody
APC00002G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human USP4 . This antibody is tested and proven to work in the following applications:
USP4 cloning plasmid
CSB-CL614393HU-10ug 10ug
EUR 919
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2892
  • Show more
Description: A cloning plasmid for the USP4 gene.
USP4 Polyclonal Antibody
ABP-PAB-31070 50 ug Ask for price
    • Product line: Proteases
    • Brand:
USP4 Polyclonal Antibody
ABP-PAB-31071 50 ug Ask for price
    • Product line: Proteases
    • Brand:
Anti-USP4 antibody
STJ11100881 100 µl
EUR 413
Description: The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene.
Anti-USP4 antibody
STJ114133 100 µl
EUR 277
Description: The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene.
Anti-USP4 (5E12)
YF-MA16029 100 ug
EUR 363
Description: Mouse monoclonal to USP4
USP4 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP4 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP4 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP4. Recognizes USP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal USP4 Antibody (Internal)
APR02105G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP4 (Internal). This antibody is tested and proven to work in the following applications:
Rat USP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse USP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP4 Polyclonal Conjugated Antibody
C27659 100ul
EUR 397
Human USP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PVT18891 2 ug
EUR 258
Anti-USP4 / UNP antibody
STJ70372 100 µg
EUR 359
Polyclonal USP4 Antibody (N-term)
APR03989G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP4 (N-term). This antibody is tested and proven to work in the following applications:
[KO Validated] USP4 Rabbit pAb
A20005-100ul 100 ul
EUR 410
[KO Validated] USP4 Rabbit pAb
A20005-200ul 200 ul
EUR 571
[KO Validated] USP4 Rabbit pAb
A20005-20ul 20 ul
EUR 221
[KO Validated] USP4 Rabbit pAb
A20005-50ul 50 ul
EUR 287
Usp4 ORF Vector (Mouse) (pORF)
ORF061148 1.0 ug DNA
EUR 506
Usp4 ORF Vector (Rat) (pORF)
ORF078702 1.0 ug DNA
EUR 506
Usp4 ORF Vector (Rat) (pORF)
ORF078703 1.0 ug DNA
EUR 506
USP4 ORF Vector (Human) (pORF)
ORF014906 1.0 ug DNA
EUR 354
pECMV-Usp4-m-FLAG Plasmid
PVT15625 2 ug
EUR 325
Polyclonal USP4 / UNP Antibody (N-Term)
APG00412G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human USP4 / UNP (N-Term). This antibody is tested and proven to work in the following applications:
Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx028210-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx028210-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx411851-50ug 50 ug
EUR 704
  • Shipped within 1 week.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody
abx430309-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Usp4 sgRNA CRISPR Lentivector set (Mouse)
K4870901 3 x 1.0 ug
EUR 339
Usp4 sgRNA CRISPR Lentivector set (Rat)
K6690001 3 x 1.0 ug
EUR 339
USP4 sgRNA CRISPR Lentivector set (Human)
K2596201 3 x 1.0 ug
EUR 339
Ubiquitin Specific Peptidase 4 (USP4) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 4 (USP4) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4870902 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4870903 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4870904 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6690002 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6690003 1.0 ug DNA
EUR 154
Usp4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6690004 1.0 ug DNA
EUR 154
USP4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2596202 1.0 ug DNA
EUR 154
USP4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2596203 1.0 ug DNA
EUR 154
USP4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2596204 1.0 ug DNA
EUR 154
USP4 Protein Vector (Mouse) (pPB-C-His)
PV244590 500 ng
EUR 1065
USP4 Protein Vector (Mouse) (pPB-N-His)
PV244591 500 ng
EUR 1065
USP4 Protein Vector (Mouse) (pPM-C-HA)
PV244592 500 ng
EUR 1065
USP4 Protein Vector (Mouse) (pPM-C-His)
PV244593 500 ng
EUR 1065
USP4 Protein Vector (Rat) (pPB-C-His)
PV314806 500 ng
EUR 1166
USP4 Protein Vector (Rat) (pPB-N-His)
PV314807 500 ng
EUR 1166
USP4 Protein Vector (Rat) (pPM-C-HA)
PV314808 500 ng
EUR 1166
USP4 Protein Vector (Rat) (pPM-C-His)
PV314809 500 ng
EUR 1166
USP4 Protein Vector (Rat) (pPB-C-His)
PV314810 500 ng
EUR 1191
USP4 Protein Vector (Rat) (pPB-N-His)
PV314811 500 ng
EUR 1191
USP4 Protein Vector (Rat) (pPM-C-HA)
PV314812 500 ng
EUR 1191
USP4 Protein Vector (Rat) (pPM-C-His)
PV314813 500 ng
EUR 1191
USP4 Protein Vector (Human) (pPB-C-His)
PV059621 500 ng
EUR 481


CKAP4 Antibody

37490-100ul 100ul
EUR 252

CKAP4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CKAP4. Recognizes CKAP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CKAP4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CKAP4. Recognizes CKAP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

CKAP4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CKAP4. Recognizes CKAP4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

CKAP4 Antibody

DF12190 200ul
EUR 304
Description: CKAP4 antibody detects endogenous levels of CKAP4.

CKAP4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CKAP4. Recognizes CKAP4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

CKAP4 antibody

70R-6704 50 ug
EUR 467
Description: Rabbit polyclonal CKAP4 antibody raised against the middle region of CKAP4

CKAP4 antibody

70R-6980 50 ug
EUR 467
Description: Rabbit polyclonal CKAP4 antibody raised against the middle region of CKAP4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CKAP4 Blocking Peptide

33R-5395 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CKAP4 antibody, catalog no. 70R-6980

CKAP4 Blocking Peptide

33R-8353 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CKAP4 antibody, catalog no. 70R-6704

CKAP4 Blocking Peptide

DF12190-BP 1mg
EUR 195

Anti-CKAP4 Antibody

A02154-1 100ug/vial
EUR 294

CKAP4 Conjugated Antibody

C37490 100ul
EUR 397

CKAP4 Rabbit pAb

A4468-100ul 100 ul
EUR 308

CKAP4 Rabbit pAb

A4468-200ul 200 ul
EUR 459

CKAP4 Rabbit pAb

A4468-20ul 20 ul Ask for price

CKAP4 Rabbit pAb

A4468-50ul 50 ul Ask for price

CKAP4 Rabbit pAb

A7777-100ul 100 ul
EUR 308

CKAP4 Rabbit pAb

A7777-200ul 200 ul
EUR 459

CKAP4 Rabbit pAb

A7777-20ul 20 ul
EUR 183

CKAP4 Rabbit pAb

A7777-50ul 50 ul
EUR 223

anti- CKAP4 antibody

FNab01725 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: cytoskeleton-associated protein 4
  • Uniprot ID: Q07065
  • Gene ID: 10970
  • Research Area: cancer
Description: Antibody raised against CKAP4

Anti-CKAP4 antibody

PAab01725 100 ug
EUR 355

Anti-CKAP4 antibody

STJ110088 100 µl
EUR 277

Anti-CKAP4 antibody

STJ13100107 100 µl
EUR 427

Anti-CKAP4 antibody

STJ23144 100 µl
EUR 277

CKAP4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CKAP4. Recognizes CKAP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CKAP4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CKAP4. Recognizes CKAP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CKAP4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CKAP4. Recognizes CKAP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF008696 96 Tests
EUR 689

Human CKAP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CKAP4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CKAP4 Recombinant Protein (Human)

RP052258 100 ug Ask for price

CKAP4 Recombinant Protein (Rat)

RP195122 100 ug Ask for price

CKAP4 Recombinant Protein (Mouse)

RP124283 100 ug Ask for price

Polyclonal CKAP4 Antibody (C-term)

APR03683G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CKAP4 (C-term). This antibody is tested and proven to work in the following applications:

Ckap4 ORF Vector (Rat) (pORF)

ORF065042 1.0 ug DNA
EUR 506

CKAP4 ORF Vector (Human) (pORF)

ORF017420 1.0 ug DNA
EUR 405

Ckap4 ORF Vector (Mouse) (pORF)

ORF041429 1.0 ug DNA
EUR 506

CKAP4 ELISA Kit (Human) (OKCA01191)

OKCA01191 96 Wells
EUR 846
Description: Description of target: High-affinity epithelial cell surface receptor for APF. Mediates the anchoring of the endoplasmic reticulum to microtubules. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.86 pg/mL

Mouse Cytoskeleton-associated protein 4 (Ckap4)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 57.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Cytoskeleton-associated protein 4(Ckap4),partial expressed in E.coli

Mouse Cytoskeleton-associated protein 4 (Ckap4)

  • EUR 389.00
  • EUR 1394.00
  • EUR 563.00
  • EUR 1025.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 56.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Cytoskeleton-associated protein 4(Ckap4),partial expressed in Mammalian cell

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

abx026767-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

abx026767-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

abx146138-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody

abx231725-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mouse Cytoskeleton-associated protein 4 (Ckap4)

  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 96.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Cytoskeleton-associated protein 4(Ckap4),partial expressed in Baculovirus

CKAP4 sgRNA CRISPR Lentivector set (Human)

K0455401 3 x 1.0 ug
EUR 339

Ckap4 sgRNA CRISPR Lentivector set (Rat)

K6273901 3 x 1.0 ug
EUR 339

Ckap4 sgRNA CRISPR Lentivector set (Mouse)

K3564801 3 x 1.0 ug
EUR 339

Cytoskeleton Associated Protein 4 (CKAP4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cytoskeleton Associated Protein 4 (CKAP4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CKAP4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0455402 1.0 ug DNA
EUR 154

CKAP4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0455403 1.0 ug DNA
EUR 154

CKAP4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0455404 1.0 ug DNA
EUR 154

Ckap4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6273902 1.0 ug DNA
EUR 154

Ckap4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6273903 1.0 ug DNA
EUR 154

Ckap4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6273904 1.0 ug DNA
EUR 154

Ckap4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3564802 1.0 ug DNA
EUR 154

Ckap4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3564803 1.0 ug DNA
EUR 154


PGA3 Antibody

31260-100ul 100ul
EUR 252

PGA3 Antibody

31260-50ul 50ul
EUR 187

PGA3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGA3. Recognizes PGA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

PGA3 Conjugated Antibody

C31260 100ul
EUR 397

PGA3 Polyclonal Antibody

A57701 100 µg
EUR 570.55
Description: kits suitable for this type of research

PGA3 Rabbit pAb

A17321-100ul 100 ul
EUR 308

PGA3 Rabbit pAb

A17321-200ul 200 ul
EUR 459

PGA3 Rabbit pAb

A17321-20ul 20 ul
EUR 183

PGA3 Rabbit pAb

A17321-50ul 50 ul
EUR 223

Anti-PGA3 antibody

STJ119451 100 µl
EUR 277
Description: This gene encodes a protein precursor of the digestive enzyme pepsin, a member of the peptidase A1 family of endopeptidases. The encoded precursor is secreted by gastric chief cells and undergoes autocatalytic cleavage in acidic conditions to form the active enzyme, which functions in the digestion of dietary proteins. This gene is found in a cluster of related genes on chromosome 11, each of which encodes one of multiple pepsinogens. Pepsinogen levels in serum may serve as a biomarker for atrophic gastritis and gastric cancer.

Human PGA3 ELISA Kit

ELA-E0632h 96 Tests
EUR 824


EF000677 96 Tests
EUR 689

PGA3 / PGA4 / PGA5 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PGA3 / PGA4 / PGA5 Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

PGA3 / PGA4 / PGA5 Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human PGA3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PGA3/PGA4/PGA5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PGA3/PGA4/PGA5. Recognizes PGA3/PGA4/PGA5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PGA3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGA3. Recognizes PGA3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PGA3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGA3. Recognizes PGA3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PGA3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PGA3. Recognizes PGA3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PGA3/PGA4/PGA5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PGA3/PGA4/PGA5. Recognizes PGA3/PGA4/PGA5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:1000-1:5000, IHC:1:50-1:200

PGA3/PGA4/PGA5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PGA3/PGA4/PGA5. Recognizes PGA3/PGA4/PGA5 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

PGA3 Recombinant Protein (Human)

RP082911 100 ug Ask for price

Polyclonal PGA3 Antibody (N-term)

AMM07114G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PGA3 (N-term). This antibody is tested and proven to work in the following applications:

Pepsin A-3 (PGA3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00