TMB Solution (500 mL Part A & 500 mL Part B)

This is a predefined sub-study of the Endothelial Dysfunction in Resuscitated Cardiac Arrest (ENDO-RCA) trial.

We aim to investigate Iloprost, a prostacyclin analogue, safety by evaluating change in whole blood platelet aggregometry (Multiplate) in out of hospital cardiac arrest (OHCA) patients from baseline to 96-h post randomization.A randomized, placebo controlled double-blinded trial in 46 OHCA patients. Patients were allocated 1:2 to 48 h Iloprost infusion, (1 ng/kg/min) or placebo (saline infusion). Platelet aggregation was determined by platelet aggregation tests ASPI-test (arachidonic acid); TRAP-test (thrombin-receptor activating peptide (TRAP)-6; RISTO test (Ristocetin); ADP test (adenosin diphosphat).

There was no significant difference between the iloprost and placebo groups according to ASPI, TRAP, RISTO and ADP platelet aggregation assays. Further, no significant differences regarding risk of bleeding were found between groups (Risk of bleeding: ASPI <40 U; TRAP <92 U; RISTO <35 U; ADP <50 U).

In conclusion, the iloprost infusion did not influence platelet aggregation as evaluated by the ASPI, TRAP, RISTO and ADP assays. There was no increased risk of bleeding or transfusion therapy. A decline in platelet aggregation was observed for the ASPI and ADP assays during the initial 96 h after OHCA.Trial registration at clinicaltrials.gov (identifier NCT02685618) on 18-02-2016.

HO-PEG-PCL(2K),2K

HE002059-2K-500mg 500mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-COOH,2K

HE084017-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-Ph,2K

HE084081-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-FITC,2K

FL001044-2K-100mg 100mg
EUR 383
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DBCO,2K

MF001048-2K-100mg 100mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-OH,2K

HO002002-2K-10g 10g
EUR 283
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Benhz-PEG-Benhz,2K

HO070070-2K-1g 1g
EUR 306
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SH-PEG-HZ,2K

HE003019-2K-1g1050 1g1050
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NH2-PEG-DBCO, 2K

HE005048-2K-500G 500G
EUR 1110
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NH2-PEG-Galactose,2K

HE005072-2K-1g 1g
EUR 359
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

ACRL-PEG-RGD,2K

HE009074-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-FA,2K

HE041057-2K-100mg 100mg
EUR 520
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-SH,2K

HE048003-2K-100mg 100mg
EUR 642
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-Mal,2K

HE048022-2K-100mg 100mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-NHS,2K

HE048023-2K-100mg 100mg
EUR 691
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-SH,2K

HE057003-2K-100mg 100mg
EUR 371
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-ALD,2K

HE057004-2K-100mg 100mg
EUR 403
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-Alkyne,2K

HE057007-2K-100mg 100mg
EUR 416
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-COOH,2K

HE057017-2K-100mg 100mg
EUR 377
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-NHS,2K

HE057023-2K-100mg 100mg
EUR 377
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(2K)-PEG-NH2,2K

HE084005-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-OH,2K

FL044002-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-SH,2K

FL044003-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-Alkyne,2K

FL044007-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-COOH,2K

FL044017-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-MAL,2K

FL044022-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-NHS,2K

FL044023-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-FITC,2K

FL044041-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-FA,2K

FL044057-2K-100mg 100mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FITC-PEG-Azithromycin,2K

FL044076-2K-100mg 100mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-OH,2K

FL045002-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-SH,2K

FL045003-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-COOH,2K

FL045017-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-Mal,2K

FL045022-2K-50mg 50mg
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-NHS,2K

FL045023-2K-50mg 50mg
EUR 457
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-Biotin,2K

FL045041-2K-50mg 50mg
EUR 482
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

RB-PEG-DSPE,2K

FL045096-2K-100mg 100mg
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-OH,2K

FL077002-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-SH,2K

FL077003-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-COOH,2K

FL077017-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-Mal,2K

FL077022-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-NHS,2K

FL077023-2K-50mg 50mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy3.5-PEG-Biotin,2K

FL077041-2K-500mg 500mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-SH,2K

FL078003-2K-50mg 50mg
EUR 568
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-COOH,2K

FL078017-2K-50mg 50mg
EUR 470
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cy5-PEG-Mal,2K

FL078022-2K-50mg 50mg
EUR 470
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY5.5-PEG-SH,2K

FL079003-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY5.5-PEG-FA,2k

FL079057-2K-100mg 100mg
EUR 790
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CY7-PEG-DSPE?2K

FL080096-2K-50mg 50mg
EUR 494
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-FITC,2K

FL096044-2K-100mg 100mg
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SS-C30, 2K

MF001092-2K-100mg 100mg
EUR 420
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cholesterol-PEG-Mal,2K

LP095022-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Cholesterol-PEG-Biotin,2K

LP095041-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CLS-PEG-FITCl,2K

LP095044-2K-100mg 100mg
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

FA-PEG-CLS,2K

LP095057-2K-100mg 100mg
EUR 445
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Alkyne-PEG-DSPE,2K

LP096007-2K-g g
EUR 617
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-Dopamine, 2K

LP096047-2K-100mg 100mg
EUR 568
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-Galactose,2K

LP096072-2K-1g 1g
EUR 852
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-RGD,2K

LP096074-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-RVG,2K

LP096094-2K-50mg 50mg
EUR 544
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Monostearate-PEG-COOH,2K

LP101017-2K-g g
EUR 519
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PCL(12K)-PEG-Mal,2K

HE062022-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(1.8K)-PEG-COOH,2K

HE083017-2K-500mg 500mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-COOH,2K

HE085017-2K-500mg 500mg
EUR 667
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-MAL,2K

HE085022-2K-500mg 500mg
EUR 728
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(5K)-PEG-NHS,2K

HE085023-2K-500mg 500mg
EUR 691
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PCL(5K)-PEG-Galactose, 2K

HE116072-2K-G G
EUR 359
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-SP2-AA,2K

LP096105-2K-500mg 500mg
EUR 605
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PLGA(50:50)?8K?-PEG-Mal,2K

HE086022-2K-500mg 500mg
EUR 642
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

2K antibody

10R-7771 500 ug
EUR 565
Description: Mouse monoclonal 2K antibody

2K DNA Marker

20-abx098045
  • EUR 258.00
  • EUR 189.00
  • 2.5 ml
  • 500 ul
  • Shipped within 5-10 working days.

mPEG-OH,2K

33-MF001002-2K
  • EUR 235.00
  • EUR 482.00
  • 10g
  • 50g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SH,2K

33-MF001003-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-CHO,2K

33-MF001004-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AlKyne,2K

33-MF001007-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Alkyene,2K

33-MF001008-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AC,2K

33-MF001009-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-ACA,2K

33-MF001010-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MA,2K

33-MF001011-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GA,2K

33-MF001012-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SA,2K

33-MF001013-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GAA,2K

33-MF001014-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SAA,2K

33-MF001015-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-PA,2K

33-MF001016-2K
  • EUR 494.00
  • EUR 198.00
  • 5G
  • G
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-COOH?2K

33-MF001017-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-IA,2K

33-MF001018-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Hydrazide,2K

33-MF001019-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Silane,2K

33-MF001020-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Epoxide,2K

33-MF001021-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-MAL,2K

33-MF001022-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SC,2K

33-MF001023-2K
  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SCM,2K

33-MF001024-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SPA,2K

33-MF001025-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SG,2K

33-MF001027-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SS,2K

33-MF001028-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-GAS,2K

33-MF001029-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-SAS,2K

33-MF001030-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-NPC,2K

33-MF001034-2K
  • EUR 149.00
  • EUR 346.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-OPSS,2K

33-MF001035-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Ts,2K

33-MF001038-2K
  • EUR 100.00
  • EUR 198.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-LA,2K

33-MF001039-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Biotin,2K

33-MF001041-2K
  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Dansyl,2K

33-MF001046-2K
  • EUR 198.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Dopamine,2K

33-MF001047-2K
  • EUR 667.00
  • EUR 1899.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DF,2K

33-MF001051-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-Br,2K

33-MF001056-2K
  • EUR 235.00
  • EUR 605.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-FA,2K

33-MF001057-2K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-CLS,2K

33-MF001095-2K
  • EUR 272.00
  • EUR 716.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DSPE,2K

33-MF001096-2K
  • EUR 211.00
  • EUR 494.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DMPE,2K

33-MF001097-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DPPE,2K

33-MF001098-2K
  • EUR 297.00
  • EUR 790.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DLPE,2K

33-MF001099-2K
  • EUR 285.00
  • EUR 753.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-AA,2K

33-MF001121-2K
  • EUR 211.00
  • EUR 531.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

mPEG-DOPE,2k

33-LP001100-2K
  • EUR 667.00
  • EUR 1899.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SH-PEG-SH,2K

33-HO003003-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

CHO-PEG-CHO,2K

33-HO004004-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AlKyne-PEG-AlKyne,2K

33-HO007007-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Alkyene-PEG-Alkyene,2K

33-HO008008-2K
  • EUR 283.00
  • EUR 747.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AC-PEG-AC,2K

33-HO009009-2K
  • EUR 167.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

ACA-PEG-ACA,2K

33-HO010010-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MA-PEG-MA,2K

33-HO011011-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GA-PEG-GA,2K

33-HO012012-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SA-PEG-SA,2K

33-HO013013-2K
  • EUR 225.00
  • EUR 573.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GAA-PEG-GAA,2K

33-HO014014-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SAA-PEG-SAA,2K

33-HO015015-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

PA-PEG-PA,2K

33-HO016016-2K
  • EUR 190.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

COOH-PEG-COOH,2K

33-HO017017-2K
  • EUR 143.00
  • EUR 422.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

IA-PEG-IA,2K

33-HO018018-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

HZ-PEG-HZ,2K

33-HO019019-2K
  • EUR 201.00
  • EUR 503.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Epoxide-PEG-Epoxide,2K

33-HO021021-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,2K

33-HO022022-2K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SC-PEG-SC,2K

33-HO023023-2K
  • EUR 143.00
  • EUR 329.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SCM-PEG-SCM,2K

33-HO024024-2K
  • EUR 167.00
  • EUR 399.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SPA-PEG-SPA,2K

33-HO025025-2K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SG-PEG-SG,2K

33-HO027027-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SS-PEG-SS,2K

33-HO028028-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

GAS-PEG-GAS,2K

33-HO029029-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

SAS-PEG-SAS,2K

33-HO030030-2K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

NPC-PEG-NPC,2K

33-HO034034-2K
  • EUR 190.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OPSS-PEG-OPSS,2K

33-HO035035-2K
  • EUR 283.00
  • EUR 747.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Tos-PEG-Tos,2k

33-HO038038-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Biotin-PEG-Biotin,2K

33-HO041041-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DBCO-PEG-DBCO,2K

33-HO048048-2K
  • EUR 422.00
  • EUR 1083.00
  • 100mg
  • 500mg
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DF-PEG-DF,2K

33-HO051051-2K
  • EUR 375.00
  • EUR 1025.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

Br-PEG-Br,2K

33-HO056056-2K
  • EUR 201.00
  • EUR 503.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

DSPE-PEG-DSPE,2K

33-HO096096-2K
  • EUR 491.00
  • EUR 1373.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

AA-PEG-AA, 2k

33-HO121121-2K
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-NHS,2K

33-HE002023-2K
  • EUR 322.00
  • EUR 864.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

OH-PEG-SCM,2K

33-HE002024-2K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

HO-PEG-AA. 2K

33-HE002121-2K
  • EUR 174.00
  • EUR 420.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

 

Platelet function testing is a cornerstone in the diagnostic investigation of patients with a bleeding history. Multiple electrode aggregometry (MEA) has been shown to detect von Willebrand disease (VWD), platelet function disorders, and drug-induced bleeding disorders. However, there are few studies supporting its successful use in children. We have implemented and used MEA over 3 years in our hemostasis laboratory in order to study its usefulness to supplement and expedite diagnosis.

This is a retrospective, single-center, cohort study of 109 hospitalized children who underwent a laboratory investigation of hemostasis and either had a reported bleeding history or an abnormal bleeding episode.

Plasmatic coagulation testing, blood counts, plasmatic von Willebrand testing, platelet function analyzer (PFA-100), and impedance aggregometry (MEA) were performed in all children. Light transmission aggregometry testing was performed as needed.

In 41 cases (37.6%), a working diagnosis was made; a primary hemostatic disorder was detected in 35 children (VWD (n = 16), platelet disorder (n = 15), and valproic acid therapy-induced bleeding disorder (n = 3), acetylsalicylic acid-related bleeding (n = 1). In patients diagnosed with VWD, MEA ristocetin-induced platelet aggregation test (RISTO) high test revealed abnormally low aggregation in six patients (43.8%); whereas in patients diagnosed with a platelet function disorder, abnormally low values were found by MEA in only three children (20%).

Three of the four children with laboratory evidence of drug-induced platelet dysfunction had abnormalities on MEA.

There were no cases in which an abnormal MEA result was used to make a previously undetermined diagnosis. Retrospectively, MEA has demonstrated limited additional diagnostic value beyond standard laboratory testing for detecting defects of primary hemostasis in children.

MSRB3

MSRB3 Antibody

1-CSB-PA810290DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MSRB3. Recognizes MSRB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MSRB3 siRNA

20-abx924813
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSRB3 siRNA

20-abx924814
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSRB3 Polyclonal Antibody

31414-100ul 100ul
EUR 252

MSRB3 Polyclonal Antibody

31414-50ul 50ul
EUR 187

MSRB3 cloning plasmid

CSB-CL810290HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 558
  • Sequence: atgtctgcattcaacctgctgcatttggtgacaaagagccagccagtagcccttcgagcctgtgggcttccctcagggtcgtgtagggataaaaagaactgtaaggtggtcttttcccagcaggaactgaggaagcggctaacacccctgcagtaccatgtcactcaggagaaagg
  • Show more
Description: A cloning plasmid for the MSRB3 gene.

MSRB3 Rabbit pAb

A8005-100ul 100 ul
EUR 308

MSRB3 Rabbit pAb

A8005-200ul 200 ul
EUR 459

MSRB3 Rabbit pAb

A8005-20ul 20 ul
EUR 183

MSRB3 Rabbit pAb

A8005-50ul 50 ul
EUR 223

anti- MSRB3 antibody

FNab05384 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:100-1:400
  • Immunogen: methionine sulfoxide reductase B3
  • Uniprot ID: Q8IXL7
  • Gene ID: 253827
  • Research Area: Metabolism
Description: Antibody raised against MSRB3

Anti-MSRB3 antibody

PAab05384 100 ug
EUR 355

Anti-MSRB3 antibody

STJ110312 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula.

MSRB3 protein (His tag)

80R-1709 50 ug
EUR 397
Description: Purified recombinant Human MSRB3 protein

Mouse Msrb3 ELISA KIT

ELI-19349m 96 Tests
EUR 865

MSRB3 ELISA KIT|Human

EF000963 96 Tests
EUR 689

Human MSRB3 shRNA Plasmid

20-abx966654
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSRB3 Polyclonal Conjugated Antibody

C31414 100ul
EUR 397

Mouse MSRB3 shRNA Plasmid

20-abx983365
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-MSRB3 Plasmid

PVT16880 2 ug
EUR 325

MSRB3 Recombinant Protein (Human)

RP020188 100 ug Ask for price

MSRB3 Recombinant Protein (Mouse)

RP151868 100 ug Ask for price

MSRB3 ORF Vector (Human) (pORF)

ORF006730 1.0 ug DNA
EUR 95

Msrb3 ORF Vector (Mouse) (pORF)

ORF050624 1.0 ug DNA
EUR 506

MSRB3 ELISA Kit (Human) (OKCA01358)

OKCA01358 96 Wells
EUR 846
Description: Description of target: Catalyzes the reduction of free and protein-bound methionine sulfoxide to methionine. Isoform 2 is essential for hearing.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

Msrb3 sgRNA CRISPR Lentivector set (Mouse)

K3627101 3 x 1.0 ug
EUR 339

MSRB3 sgRNA CRISPR Lentivector set (Human)

K1350701 3 x 1.0 ug
EUR 339

Human Methionine-R-sulfoxide reductase B3 (MSRB3)

1-CSB-EP810290HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Methionine-R-sulfoxide reductase B3(MSRB3) expressed in E.coli

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

20-abx006684
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

20-abx141552
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

abx235384-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

20-abx322550
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methionine-R-Sulfoxide Reductase B3 (MSRB3) Antibody

20-abx322551
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3627102 1.0 ug DNA
EUR 154

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3627103 1.0 ug DNA
EUR 154

Msrb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3627104 1.0 ug DNA
EUR 154

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1350702 1.0 ug DNA
EUR 154

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1350703 1.0 ug DNA
EUR 154

MSRB3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1350704 1.0 ug DNA
EUR 154

MSRB3 Protein Vector (Mouse) (pPB-C-His)

PV202494 500 ng
EUR 1065

MSRB3 Protein Vector (Mouse) (pPB-N-His)

PV202495 500 ng
EUR 1065

MSRB3 Protein Vector (Mouse) (pPM-C-HA)

PV202496 500 ng
EUR 1065

MSRB3 Protein Vector (Mouse) (pPM-C-His)

PV202497 500 ng
EUR 1065

MSRB3 Protein Vector (Human) (pPB-C-His)

PV026917 500 ng
EUR 329

MSRB3 Protein Vector (Human) (pPB-N-His)

PV026918 500 ng
EUR 329

MSRB3 Protein Vector (Human) (pPM-C-HA)

PV026919 500 ng
EUR 329

MSRB3 Protein Vector (Human) (pPM-C-His)

PV026920 500 ng
EUR 329

Recombinant Human MSRB3 Protein, GST, E.coli-100ug

QP7810-ec-100ug 100ug
EUR 408

Recombinant Human MSRB3 Protein, GST, E.coli-10ug

QP7810-ec-10ug 10ug
EUR 200

Recombinant Human MSRB3 Protein, GST, E.coli-1mg

QP7810-ec-1mg 1mg
EUR 1632

Recombinant Human MSRB3 Protein, GST, E.coli-200ug

QP7810-ec-200ug 200ug
EUR 634

Recombinant Human MSRB3 Protein, GST, E.coli-500ug

QP7810-ec-500ug 500ug
EUR 1060

Recombinant Human MSRB3 Protein, GST, E.coli-50ug

QP7810-ec-50ug 50ug
EUR 263

Msrb3 3'UTR Luciferase Stable Cell Line

TU113533 1.0 ml Ask for price

Msrb3 3'UTR GFP Stable Cell Line

TU163533 1.0 ml Ask for price

MSRB3 3'UTR GFP Stable Cell Line

TU064779 1.0 ml
EUR 2333

MSRB3 3'UTR Luciferase Stable Cell Line

TU014779 1.0 ml
EUR 2333

MSRB3 Methionine Sulfoxide Reductase B3 Human Recombinant Protein

PROTQ8IXL7 Regular: 10ug
EUR 317
Description: MSRB3 Human Recombinant fused with an 8 amino acid His tag at C-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 174 amino acids (21-185 a.a.) and having a molecular mass of 19kDa. The MSRB3 is purified by proprietary chromatographic techniques.

Human Methionine- R- sulfoxide reductase B3, MSRB3 ELISA KIT

ELI-14242h 96 Tests
EUR 824

Mouse Methionine-R-sulfoxide reductase B3 (MSRB3) ELISA Kit

abx389867-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Msrb3 ELISA Kit| Mouse Methionine-R-sulfoxide reductase B3 ELIS

EF015503 96 Tests
EUR 689

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3627105 3 x 1.0 ug
EUR 376

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1350705 3 x 1.0 ug
EUR 376

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3627106 1.0 ug DNA
EUR 167

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3627107 1.0 ug DNA
EUR 167

Msrb3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3627108 1.0 ug DNA
EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1350706 1.0 ug DNA
EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1350707 1.0 ug DNA
EUR 167

MSRB3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1350708 1.0 ug DNA
EUR 167

NEDD8

Human NEDD8, NEDD8 ELISA KIT

ELI-16853h 96 Tests
EUR 824

Rabbit NEDD8, NEDD8 ELISA KIT

ELI-20691Ra 96 Tests
EUR 928

Bovine NEDD8, NEDD8 ELISA KIT

ELI-45662b 96 Tests
EUR 928

Mouse NEDD8, Nedd8 ELISA KIT

ELI-39574m 96 Tests
EUR 865

Nedd8/ Rat Nedd8 ELISA Kit

ELI-39575r 96 Tests
EUR 886

NEDD8 protein

30R-2728 25 ug
EUR 403
Description: Synthetic NEDD8 protein

NEDD8 antibody

70R-18833 50 ul
EUR 435
Description: Rabbit polyclonal NEDD8 antibody

NEDD8 antibody

70R-30793 100 ug
EUR 327
Description: Rabbit polyclonal NEDD8 antibody

NEDD8 Antibody

33513-100ul 100ul
EUR 252

NEDD8 Antibody

33513-50ul 50ul
EUR 187

NEDD8 Antibody

32194-100ul 100ul
EUR 252

NEDD8-AMC

4843-25
EUR 305

NEDD8 Antibody

49398-100ul 100ul
EUR 333

NEDD8 Antibody

49398-50ul 50ul
EUR 239

NEDD8 Antibody

1-CSB-PA003391
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

NEDD8 Antibody

CSB-PA053660-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NEDD8 Antibody

CSB-PA053660-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NEDD8 Antibody

1-CSB-PA618018ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

NEDD8 Antibody

1-CSB-PA618018ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

NEDD8 Antibody

DF6297 200ul
EUR 304
Description: NEDD8 Antibody detects endogenous levels of total NEDD8.

NEDD8 Antibody

1-CSB-PA015684GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NEDD8. Recognizes NEDD8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NEDD8 antibody

70R-50112 100 ul
EUR 244
Description: Purified Polyclonal NEDD8 antibody

NEDD8 Antibody

AF0271 200ul
EUR 304
Description: NEDD8 antibody detects endogenous levels of total NEDD8.

NEDD8 Antibody

BF0274 200ul
EUR 376
Description: NEDD8 antibody detects endogenous levels of total NEDD8.

NEDD8 siRNA

20-abx903522
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEDD8 siRNA

20-abx925690
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEDD8 siRNA

20-abx925691
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEDD8 Antibody

ABD13178 100 ug
EUR 438

NEDD8 Antibody

ABD6297 100 ug
EUR 438

NEDD8 Antibody

ABF0271 100 ug
EUR 438

anti-NEDD8

YF-PA24225 50 ul
EUR 334
Description: Mouse polyclonal to NEDD8

NEDD8 Rabbit pAb

A13520-100ul 100 ul
EUR 308

NEDD8 Rabbit pAb

A13520-200ul 200 ul
EUR 459

NEDD8 Rabbit pAb

A13520-20ul 20 ul
EUR 183

NEDD8 Rabbit pAb

A13520-50ul 50 ul
EUR 223

NEDD8 Rabbit pAb

A1163-100ul 100 ul
EUR 308

NEDD8 Rabbit pAb

A1163-200ul 200 ul
EUR 459

NEDD8 Rabbit pAb

A1163-20ul 20 ul
EUR 183

NEDD8 Rabbit pAb

A1163-50ul 50 ul
EUR 223

NEDD8 Rabbit pAb

A0591-100ul 100 ul
EUR 384

NEDD8 Rabbit pAb

A0591-200ul 200 ul Ask for price

NEDD8 Rabbit pAb

A0591-20ul 20 ul Ask for price

NEDD8 Rabbit pAb

A0591-50ul 50 ul
EUR 265

Human NEDD8 Antibody

32539-05111 150 ug
EUR 261

NEDD8 Blocking Peptide

DF6297-BP 1mg
EUR 195

Anti-NEDD8 Antibody

A00547 100ug/vial
EUR 334

NEDD8 Blocking Peptide

20-abx062987
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NEDD8 Conjugated Antibody

C49398 100ul
EUR 397

NEDD8 Blocking Peptide

AF0271-BP 1mg
EUR 195

NEDD8 Conjugated Antibody

C32194 100ul
EUR 397

NEDD8 Blocking Peptide

BF0274-BP 1mg
EUR 195

NEDD8 cloning plasmid

CSB-CL618018HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 246
  • Sequence: ATGCTAATTAAAGTGAAGACGCTGACCGGAAAGGAGATTGAGATTGACATTGAACCTACAGACAAGGTGGAGCGAATCAAGGAGCGTGTGGAGGAGAAAGAGGGAATCCCCCCACAACAGCAGAGGCTCATCTACAGTGGCAAGCAGATGAATGATGAGAAGACAGCAGCTGATTA
  • Show more
Description: A cloning plasmid for the NEDD8 gene.

anti- NEDD8 antibody

FNab05647 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: neural precursor cell expressed, developmentally down-regulated 8
  • Uniprot ID: Q15843
  • Gene ID: 4738
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against NEDD8

anti-NEDD8 (1A7)

LF-MA30675 100 ul
EUR 527
Description: Mouse Monoclonal to NEDD8

anti-NEDD8 (5B8)

LF-MA30676 100 ul
EUR 527
Description: Mouse Monoclonal to NEDD8

Anti-NEDD8 antibody

PAab05647 100 ug
EUR 355

Anti-NEDD8 antibody

STJ24730 100 µl
EUR 393

Anti-NEDD8 antibody

STJ115481 100 µl
EUR 277

Anti-NEDD8 antibody

STJ29839 100 µl
EUR 277

NEDD8 protein (His tag)

80R-1104 100 ug
EUR 305
Description: Purified recombinant Human NEDD8 protein

NEDD8 ELISA KIT|Human

EF001168 96 Tests
EUR 689

Mouse NEDD8 shRNA Plasmid

20-abx971707
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NEDD8 shRNA Plasmid

20-abx985064
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEDD8 Cell ELISA Kit

abx595417-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

NEDD8 conjugating enzyme Antibody

abx432110-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human NEDD8 shRNA Plasmid

20-abx953147
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEDD8 recombinant monoclonal antibody

A5205 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NEDD8 for WB, IF,ELISA

pDNR-LIB-NEDD8 Plasmid

PVT15936 2 ug
EUR 325

Recombinant Human NEDD8 Protein

RP00059 5 μg
EUR 174

Nedd8 Recombinant Protein (Human)

RP041608 100 ug Ask for price

Nedd8 Recombinant Protein (Mouse)

RP153605 100 ug Ask for price

Nedd8 Recombinant Protein (Rat)

RP213632 100 ug Ask for price

Human NEDD8 Antibody (Biotin Conjugate)

32539-05121 150 ug
EUR 369

Polyclonal NEDD8 Antibody (aa10-59)

APR02835G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEDD8 (aa10-59). This antibody is tested and proven to work in the following applications:

Monoclonal NEDD8 Antibody, Clone: 1A7

APR08709G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NEDD8. The antibodies are raised in Mouse and are from clone 1A7. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal NEDD8 Antibody, Clone: 5B8

APR08710G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NEDD8. The antibodies are raised in Mouse and are from clone 5B8. This antibody is applicable in WB and IHC, FC, ICC, E

Anti-NEDD8 Rabbit Monoclonal Antibody

M00547 100ug/vial
EUR 397
Description: Rabbit Monoclonal NEDD8 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Nedd8 ORF Vector (Rat) (pORF)

ORF071212 1.0 ug DNA
EUR 506

NEDD8 ORF Vector (Human) (pORF)

ORF013870 1.0 ug DNA
EUR 95

Nedd8 ORF Vector (Mouse) (pORF)

ORF051203 1.0 ug DNA
EUR 506

NEDD8-MDP1 Recombinant Protein (Human)

RP078063 100 ug Ask for price

mlN4924 (NEDD8 activating enzyme inhibitor)

SIH-331-1MG 1 mg
EUR 1004
  • Potent and selective NEDD8-activating enzyme (NAE) inhibitor. It disrupts cullin-RING ligase-mediated protein turnover leading to apoptosis in human tumor cells. It suppresses the growth of human tumor xenografts in mice. Cell permeable.
Description: The substance mlN4924 is a nedd8 activating enzyme inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is white powder which is soluble in 10 mg/ml DMSO.

mlN4924 (NEDD8 activating enzyme inhibitor)

SIH-331-200UG 200 µg
EUR 312
  • Potent and selective NEDD8-activating enzyme (NAE) inhibitor. It disrupts cullin-RING ligase-mediated protein turnover leading to apoptosis in human tumor cells. It suppresses the growth of human tumor xenografts in mice. Cell permeable.
Description: The substance mlN4924 is a nedd8 activating enzyme inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is white powder which is soluble in 10 mg/ml DMSO.

Human NEDD8 AssayLite Antibody (FITC Conjugate)

32539-05141 150 ug
EUR 428

Human NEDD8 AssayLite Antibody (RPE Conjugate)

32539-05151 150 ug
EUR 428

Human NEDD8 AssayLite Antibody (APC Conjugate)

32539-05161 150 ug
EUR 428

Human NEDD8 AssayLite Antibody (PerCP Conjugate)

32539-05171 150 ug
EUR 471

Human NEDD8-conjugating enzyme UBE2F (UBE2F)

1-CSB-EP850248HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human NEDD8-conjugating enzyme UBE2F(UBE2F) expressed in E.coli