TNIP1

TNIP1 antibody
70R-10358 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TNIP1 antibody
TNIP1 antibody
70R-20900 50 ul
EUR 435
Description: Rabbit polyclonal TNIP1 antibody
TNIP1 Antibody
40258-100ul 100ul
EUR 252
TNIP1 Antibody
1-CSB-PA619959LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNIP1. Recognizes TNIP1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200
TNIP1 Antibody
1-CSB-PA944797
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TNIP1. Recognizes TNIP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
TNIP1 Antibody
1-CSB-PA969029
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TNIP1. Recognizes TNIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
TNIP1 Antibody
DF12778 200ul
EUR 304
Description: TNIP1 Antibody detects endogenous levels of TNIP1.
TNIP1 Antibody
1-CSB-PA023999GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TNIP1. Recognizes TNIP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
TNIP1 siRNA
20-abx937647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TNIP1 siRNA
20-abx937648
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TNIP1
YF-PA16875 50 ug
EUR 363
Description: Mouse polyclonal to TNIP1
TNIP1 Blocking Peptide
33R-10405 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNIP1 antibody, catalog no. 70R-10358
TNIP1 Blocking Peptide
33R-6887 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNIP1 antibody, catalog no. 70R-10357
TNIP1 Blocking Peptide
DF12778-BP 1mg
EUR 195
TNIP1 Conjugated Antibody
C40258 100ul
EUR 397
TNIP1 cloning plasmid
CSB-CL619959HU1-10ug 10ug
EUR 644
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1911
  • Sequence: atggaagggagaggaccgtaccggatctacgaccctgggggcagcgtgccctcaggagaggcatccgcagcttttgagcgcctagtgaaggagaattcccggctgaaggaaaaaatgcaagggataaagatgttaggggagcttttggaagagtcccagatggaagcgaccaggc
  • Show more
Description: A cloning plasmid for the TNIP1 gene.
TNIP1 cloning plasmid
CSB-CL619959HU2-10ug 10ug
EUR 644
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1911
  • Sequence: atggaagggagaggaccgtaccggatctacgaccctgggggcagcgtgccctcaggagaggcatccgcagcttttgagcgcctagtgaaggagaattcccggctgaaggaaaaaatgcaagggataaagatgttaggggagcttttggaagagtcccagatggaagcgaccaggc
  • Show more
Description: A cloning plasmid for the TNIP1 gene.
TNIP1 cloning plasmid
CSB-CL619959HU3-10ug 10ug
EUR 640
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggaagggagaggaccgtaccggatctacgaccctgggggcagcgtgccctcaggagaggcatccgcagcttttgagcgcctagtgaaggagaattcccggctgaaggaaaaaatgcaagggataaagatgttaggggagcttttggaagagtcccagatggaagcgaccaggc
  • Show more
Description: A cloning plasmid for the TNIP1 gene.
TNIP1 Rabbit pAb
A4404-100ul 100 ul
EUR 308
TNIP1 Rabbit pAb
A4404-200ul 200 ul
EUR 459
TNIP1 Rabbit pAb
A4404-20ul 20 ul Ask for price
TNIP1 Rabbit pAb
A4404-50ul 50 ul Ask for price
TNIP1 Polyclonal Antibody
A68863 100 ?g
EUR 628.55
Description: Ask the seller for details
anti- TNIP1 antibody
FNab08831 100µg
EUR 585
  • Immunogen: TNFAIP3 interacting protein 1
  • Uniprot ID: Q15025
  • Gene ID: 10318
  • Research Area: Immunology, Metabolism
Description: Antibody raised against TNIP1
Anti-TNIP1 antibody
PAab08831 100 ug
EUR 412
Anti-TNIP1 antibody
STJ25903 100 µl
EUR 277
Description: This gene encodes an A20-binding protein which plays a role in autoimmunity and tissue homeostasis through the regulation of nuclear factor kappa-B activation. Mutations in this gene have been associated with psoriatic arthritis, rheumatoid arthritis, and systemic lupus erythematosus. Multiple transcript variants encoding different isoforms have been found for this gene.
TNIP1 Antibody, HRP conjugated
1-CSB-PA619959LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNIP1. Recognizes TNIP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TNIP1 Antibody, FITC conjugated
1-CSB-PA619959LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNIP1. Recognizes TNIP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TNIP1 Antibody, Biotin conjugated
1-CSB-PA619959LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNIP1. Recognizes TNIP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TNIP1 protein (His tag)
80R-1541 10 ug
EUR 305
Description: Purified recombinant Human TNIP1 protein
TNIP1 ELISA KIT|Human
EF003721 96 Tests
EUR 689
Mouse TNIP1 shRNA Plasmid
20-abx975032
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TNIP1 shRNA Plasmid
20-abx956991
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TNIP1 Recombinant Protein (Rat)
RP234116 100 ug Ask for price
TNIP1 Recombinant Protein (Human)
RP032470 100 ug Ask for price
TNIP1 Recombinant Protein (Human)
RP032473 100 ug Ask for price
TNIP1 Recombinant Protein (Human)
RP032476 100 ug Ask for price
TNIP1 Recombinant Protein (Mouse)
RP180317 100 ug Ask for price
TNIP1 Recombinant Protein (Mouse)
RP180320 100 ug Ask for price
TNIP1 Recombinant Protein (Mouse)
RP180323 100 ug Ask for price
Polyclonal TNIP1 Antibody (C-term)
APR04160G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNIP1 (C-term). This antibody is tested and proven to work in the following applications:
TNIP1 Polyclonal Antibody, HRP Conjugated
A68864 100 ?g
EUR 628.55
Description: The best epigenetics products
TNIP1 Polyclonal Antibody, FITC Conjugated
A68865 100 ?g
EUR 628.55
Description: kits suitable for this type of research
TNIP1 Polyclonal Antibody, Biotin Conjugated
A68866 100 ?g
EUR 628.55
Description: fast delivery possible
Tnip1 ORF Vector (Rat) (pORF)
ORF078040 1.0 ug DNA
EUR 506
h TNIP1 inducible lentiviral particles
LVP900 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: TNIP1 (TNFAIP3 interacting protein 1), [alternative names: ABIN-1; NAF1; nip40-1; VAN]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001252385.1. It also contains a RFP-Blasticidin dual selection marker.
TNIP1 ORF Vector (Human) (pORF)
ORF010824 1.0 ug DNA
EUR 95
TNIP1 ORF Vector (Human) (pORF)
ORF010825 1.0 ug DNA
EUR 95
TNIP1 ORF Vector (Human) (pORF)
ORF010826 1.0 ug DNA
EUR 95
Tnip1 ORF Vector (Mouse) (pORF)
ORF060107 1.0 ug DNA
EUR 506
Tnip1 ORF Vector (Mouse) (pORF)
ORF060108 1.0 ug DNA
EUR 506
Tnip1 ORF Vector (Mouse) (pORF)
ORF060109 1.0 ug DNA
EUR 506
TNIP1 ELISA Kit (Human) (OKCA01546)
OKCA01546 96 Wells
EUR 846
Description: Description of target: Inhibits NF-kappa-B activation and TNF-induced NF-kappa-B-dependent gene expression by regulating A20/TNFAIP3-mediated deubiquitination of IKBKG; proposed to link A20/TNFAIP3 to ubiquitinated IKBKG. Involved in regulation of EGF-induced ERK1/ERK2 signaling pathway; blocks MAPK3/MAPK1 nuclear translocation and MAPK1-dependent transcription. Increases cell surface CD4(T4) antigen expression. Involved in the anti-inflammatory response of macrophages and positively regulates TLR-induced activation of CEBPB. Involved in the prevention of autoimmunity; this function implicates binding to polyubiquitin. Involved in leukocyte integrin activation during inflammation; this function is mediated by association with SELPLG and dependent on phosphorylation by SRC-family kinases. Interacts with HIV-1 matrix protein and is packaged into virions and overexpression can inhibit viral replication. May regulate matrix nuclear localization, both nuclear import of PIC (Preintegration complex) and export of GAG polyprotein and viral genomic RNA during virion production. In case of infection, promotes association of IKBKG with Shigella flexneri E3 ubiquitin-protein ligase ipah9.8 p which in turn promotes polyubiquitination of IKBKG leading to its proteasome-dependent degradation and thus is perturbing NF-kappa-B activation during bacterial infection.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.8 pg/mL
TNFAIP3-Interacting Protein 1 (TNIP1) Antibody
20-abx003286
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx211190
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx213274
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tnfaip3 Interacting Protein 1 (TNIP1) Antibody
20-abx116119
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
TNFAIP3-Interacting Protein 1 (TNIP1) Antibody
abx145334-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
TNFAIP3-Interacting Protein 1 (TNIP1) Antibody
abx029201-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
TNFAIP3-Interacting Protein 1 (TNIP1) Antibody
abx029201-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
TNFAIP3-Interacting Protein 1 (TNIP1) Antibody
abx238831-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody
20-abx338692
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tnip1 sgRNA CRISPR Lentivector set (Mouse)
K4668201 3 x 1.0 ug
EUR 339
Tnip1 sgRNA CRISPR Lentivector set (Rat)
K6431501 3 x 1.0 ug
EUR 339
TNIP1 sgRNA CRISPR Lentivector set (Human)
K2418201 3 x 1.0 ug
EUR 339
TNFAIP3-interacting protein 1 (TNIP1) Antibody (HRP)
20-abx337975
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody (FITC)
20-abx337976
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TNFAIP3-interacting protein 1 (TNIP1) Antibody (Biotin)
20-abx337977
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tnip1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4668202 1.0 ug DNA
EUR 154
Tnip1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4668203 1.0 ug DNA
EUR 154
Tnip1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4668204 1.0 ug DNA
EUR 154
Tnip1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6431502 1.0 ug DNA
EUR 154
Tnip1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6431503 1.0 ug DNA
EUR 154
Tnip1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6431504 1.0 ug DNA
EUR 154
TNIP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2418202 1.0 ug DNA
EUR 154