PGM3

PGM3 siRNA

20-abx928385
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PGM3 antibody

70R-4450 50 ug
EUR 467
Description: Rabbit polyclonal PGM3 antibody raised against the N terminal of PGM3

PGM3 antibody

70R-3268 50 ug
EUR 467
Description: Rabbit polyclonal PGM3 antibody raised against the middle region of PGM3

PGM3 antibody

22244-100ul 100ul
EUR 390

PGM3 antibody

70R-13614 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PGM3 antibody

anti-PGM3

YF-PA13762 50 ug
EUR 363
Description: Mouse polyclonal to PGM3

anti-PGM3

YF-PA13763 100 ug
EUR 403
Description: Rabbit polyclonal to PGM3

anti-PGM3

YF-PA27323 50 ul
EUR 363
Description: Mouse polyclonal to PGM3

PGM3 cloning plasmid

CSB-CL017869HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1629
  • Sequence: atggatttaggtgctattacaaaatactcagcattacacgccaagcccaatggactgatccttcaatacgggactgctggatttcgaacgaaggcagaacatcttgatcatgtcatgtttcgcatgggattattagctgtcctgaggtcaaaacagacaaaatccactataggag
  • Show more
Description: A cloning plasmid for the PGM3 gene.

PGM3 Rabbit pAb

A15698-100ul 100 ul
EUR 308

PGM3 Rabbit pAb

A15698-200ul 200 ul
EUR 459

PGM3 Rabbit pAb

A15698-20ul 20 ul
EUR 183

PGM3 Rabbit pAb

A15698-50ul 50 ul
EUR 223

PGM3 Rabbit pAb

A15699-100ul 100 ul
EUR 308

PGM3 Rabbit pAb

A15699-200ul 200 ul
EUR 459

PGM3 Rabbit pAb

A15699-20ul 20 ul
EUR 183

PGM3 Rabbit pAb

A15699-50ul 50 ul
EUR 223

PGM3 Blocking Peptide

33R-3660 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGM3 antibody, catalog no. 70R-3268

PGM3 Blocking Peptide

33R-3917 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGM3 antibody, catalog no. 70R-4450

PGM3 Polyclonal Antibody

29391-100ul 100ul
EUR 252

PGM3 Polyclonal Antibody

29391-50ul 50ul
EUR 187

PGM3 Polyclonal Antibody

29392-100ul 100ul
EUR 252

PGM3 Polyclonal Antibody

29392-50ul 50ul
EUR 187

pCMV-SPORT6-PGM3

PVT12589 2 ug
EUR 391

Anti-PGM3 antibody

STJ118158 100 µl
EUR 277

Anti-PGM3 antibody

STJ118159 100 µl
EUR 277

PGM3 Polyclonal Conjugated Antibody

C29391 100ul
EUR 397

PGM3 Polyclonal Conjugated Antibody

C29392 100ul
EUR 397

Mouse PGM3 shRNA Plasmid

20-abx980023
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PGM3 ELISA KIT|Human

EF005420 96 Tests
EUR 689

Phosphoacetylglucosamine Mutase (PGM3) Antibody

abx036076-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phosphoacetylglucosamine Mutase (PGM3) Antibody

abx030607-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phosphoacetylglucosamine Mutase (PGM3) Antibody

abx030607-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human PGM3 shRNA Plasmid

20-abx953498
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Phosphoacetylglucosamine mutase (PGM3)

1-CSB-EP017869HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 75.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phosphoacetylglucosamine mutase(PGM3) expressed in E.coli

anti-PGM3 (1E2-1B12)

LF-MA10229 100 ug
EUR 363
Description: Mouse monoclonal to PGM3

Recombinant Phosphoglucomutase 3 (PGM3)

4-RPE743Hu01
  • EUR 395.68
  • EUR 209.00
  • EUR 1208.80
  • EUR 469.60
  • EUR 839.20
  • EUR 328.00
  • EUR 2872.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95394
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.6kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Phosphoglucomutase 3 expressed in: E.coli

Recombinant Phosphoglucomutase 3 (PGM3)

4-RPE743Mu01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CYR6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.7kDa
  • Isoelectric Point: 6.4
Description: Recombinant Mouse Phosphoglucomutase 3 expressed in: E.coli

PGM3 Recombinant Protein (Human)

RP023254 100 ug Ask for price

PGM3 Recombinant Protein (Rat)

RP220238 100 ug Ask for price

PGM3 Recombinant Protein (Mouse)

RP161609 100 ug Ask for price

PGM3 Recombinant Protein (Mouse)

RP161612 100 ug Ask for price

Human Phosphoacetylglucosamine Mutase (PGM3) Protein

20-abx650908
  • EUR 565.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 662.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Phosphoacetylglucosamine Mutase (PGM3) Protein

20-abx650909
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PGM3 ORF Vector (Human) (pORF)

ORF007752 1.0 ug DNA
EUR 95

Pgm3 ORF Vector (Rat) (pORF)

ORF073414 1.0 ug DNA
EUR 506

Pgm3 ORF Vector (Mouse) (pORF)

ORF053871 1.0 ug DNA
EUR 506

Pgm3 ORF Vector (Mouse) (pORF)

ORF053872 1.0 ug DNA
EUR 506

Human Phosphoacetylglucosamine mutase, PGM3 ELISA KIT

ELI-24831h 96 Tests
EUR 824

Mouse Phosphoglucomutase 3(PGM3)ELISA kit

GA-E0747MS-48T 48T
EUR 336

Mouse Phosphoglucomutase 3(PGM3)ELISA kit

GA-E0747MS-96T 96T
EUR 534

Mouse Phosphoacetylglucosamine mutase, Pgm3 ELISA KIT

ELI-49542m 96 Tests
EUR 865

Human Phosphoacetylglucosamine mutase (PGM3) ELISA Kit

abx385275-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Phosphoacetylglucosamine mutase (PGM3) ELISA Kit

abx390215-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Phosphoglucomutase 3 (PGM3)ELISA kit

201-12-2213 96 tests
EUR 440
  • This Phosphoglucomutase 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.