RPL19 antibody
70R-19969	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RPL19 antibody

RPL19 Antibody
DF3701	Affbiotech	200ul	EUR 304
Description: RPL19 Antibody detects endogenous levels of total RPL19.

RPL19 Antibody
1-CSB-PA020160GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL19 Antibody
1-CSB-PA020160LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

RPL19 siRNA
20-abx904652	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL19 siRNA
20-abx931929	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL19 siRNA
20-abx931930	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL19 Antibody
ABD3701	Lifescience Market	100 ug	EUR 438

RPL19 Blocking Peptide
DF3701-BP	Affbiotech	1mg	EUR 195

RPL19 cloning plasmid
CSB-CL020160HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 591 Sequence: atgagtatgctcaggcttcagaagaggctcgcctctagtgtcctccgctgtggcaagaagaaggtctggttagaccccaatgagaccaatgaaatcgccaatgccaactcccgtcagcagatccggaagctcatcaaagatgggctgatcatccgcaagcctgtgacggtccattc Show more
Description: A cloning plasmid for the RPL19 gene.

anti- RPL19 antibody
FNab07419	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L19 Uniprot ID: P84098 Gene ID: 6143 Research Area: Cancer, Metabolism
Description: Antibody raised against RPL19

Anti-RPL19 antibody
PAab07419	Lifescience Market	100 ug	EUR 386

Anti-RPL19 Antibody
PB10092	BosterBio	100ug/vial	EUR 294

Anti-RPL19 (3H4)
YF-MA10792	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RPL19

Canine RPL19 ELISA KIT
ELI-18461d	Lifescience Market	96 Tests	EUR 928

RPL19 ELISA KIT|Human
EF002576	Lifescience Market	96 Tests	EUR 689

Mouse RPL19 shRNA Plasmid
20-abx972489	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RPL19 shRNA Plasmid
20-abx986701	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL19 Antibody, HRP conjugated
1-CSB-PA020160LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL19 Antibody, FITC conjugated
1-CSB-PA020160LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL19 Antibody, Biotin conjugated
1-CSB-PA020160LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RPL19 shRNA Plasmid
20-abx954133	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL19 Recombinant Protein (Human)
RP026896	ABM	100 ug	Ask for price

RPL19 Recombinant Protein (Mouse)
RP168986	ABM	100 ug	Ask for price

RPL19 Recombinant Protein (Mouse)
RP168989	ABM	100 ug	Ask for price

RPL19 Recombinant Protein (Rat)
RP226625	ABM	100 ug	Ask for price

Ribosomal Protein L19 (RPL19) Antibody
20-abx115230	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L19 (RPL19) Antibody
abx237419-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ribosomal Protein L19 (RPL19) Antibody
20-abx318246	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L19 (RPL19) Antibody
abx430979-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Rpl19 ORF Vector (Rat) (pORF)
ORF075543	ABM	1.0 ug DNA	EUR 506

RPL19 ORF Vector (Human) (pORF)
ORF008966	ABM	1.0 ug DNA	EUR 95

Rpl19 ORF Vector (Mouse) (pORF)
ORF056330	ABM	1.0 ug DNA	EUR 506

Rpl19 ORF Vector (Mouse) (pORF)
ORF056331	ABM	1.0 ug DNA	EUR 506

Polyclonal RPL19 antibody - C-terminal region
APR01581G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPL19 - C-terminal region. This antibody is tested and proven to work in the following applications:

Ribosomal Protein L19 (RPL19) Antibody (HRP)
20-abx315987	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L19 (RPL19) Antibody (FITC)
20-abx315988	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L19 (RPL19) Antibody (Biotin)
20-abx315989	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rpl19 sgRNA CRISPR Lentivector set (Mouse)
K4968501	ABM	3 x 1.0 ug	EUR 339

Rpl19 sgRNA CRISPR Lentivector set (Rat)
K7021901	ABM	3 x 1.0 ug	EUR 339

RPL19 sgRNA CRISPR Lentivector set (Human)
K1920301	ABM	3 x 1.0 ug	EUR 339

Anti-Ribosomal Protein L19 / RPL19 antibody
STJ70939	St John's Laboratory	100 µg	EUR 359

Human Ribosomal Protein L19 (RPL19) ELISA Kit
abx382904-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Monoclonal RPL19 Antibody (monoclonal) (M01), Clone: 3H4
AMM04043G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RPL19 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3H4. This antibody is applicable in WB, IHC and IF, E

Rpl19 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4968502	ABM	1.0 ug DNA	EUR 154

Rpl19 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4968503	ABM	1.0 ug DNA	EUR 154

Rpl19 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4968504	ABM	1.0 ug DNA	EUR 154

Rpl19 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7021902	ABM	1.0 ug DNA	EUR 154

Rpl19 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7021903	ABM	1.0 ug DNA	EUR 154

Rpl19 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7021904	ABM	1.0 ug DNA	EUR 154

RPL19 sgRNA CRISPR Lentivector (Human) (Target 1)
K1920302	ABM	1.0 ug DNA	EUR 154

RPL19 sgRNA CRISPR Lentivector (Human) (Target 2)
K1920303	ABM	1.0 ug DNA	EUR 154

RPL19 sgRNA CRISPR Lentivector (Human) (Target 3)
K1920304	ABM	1.0 ug DNA	EUR 154

RPL19 Protein Vector (Rat) (pPB-C-His)
PV302170	ABM	500 ng	EUR 603

RPL19 Protein Vector (Rat) (pPB-N-His)
PV302171	ABM	500 ng	EUR 603

RPL19 Protein Vector (Rat) (pPM-C-HA)
PV302172	ABM	500 ng	EUR 603

RPL19 Protein Vector (Rat) (pPM-C-His)
PV302173	ABM	500 ng	EUR 603

RPL19 Protein Vector (Human) (pPB-C-His)
PV035861	ABM	500 ng	EUR 329

RPL19 Protein Vector (Human) (pPB-N-His)
PV035862	ABM	500 ng	EUR 329

RPL19 Protein Vector (Human) (pPM-C-HA)
PV035863	ABM	500 ng	EUR 329

RPL19 Protein Vector (Human) (pPM-C-His)
PV035864	ABM	500 ng	EUR 329

RPL19 Protein Vector (Mouse) (pPB-C-His)
PV225318	ABM	500 ng	EUR 603

RPL19 Protein Vector (Mouse) (pPB-N-His)
PV225319	ABM	500 ng	EUR 603

RPL19 Protein Vector (Mouse) (pPM-C-HA)
PV225320	ABM	500 ng	EUR 603

RPL19 Protein Vector (Mouse) (pPM-C-His)
PV225321	ABM	500 ng	EUR 603

RPL19 Protein Vector (Mouse) (pPB-C-His)
PV225322	ABM	500 ng	EUR 603

RPL19 Protein Vector (Mouse) (pPB-N-His)
PV225323	ABM	500 ng	EUR 603

RPL19 Protein Vector (Mouse) (pPM-C-HA)
PV225324	ABM	500 ng	EUR 603

RPL19 Protein Vector (Mouse) (pPM-C-His)
PV225325	ABM	500 ng	EUR 603

Rpl19 3'UTR Luciferase Stable Cell Line
TU118081	ABM	1.0 ml	Ask for price

Rpl19 3'UTR GFP Stable Cell Line
TU168081	ABM	1.0 ml	Ask for price

Rpl19 3'UTR Luciferase Stable Cell Line
TU219624	ABM	1.0 ml	Ask for price

Rpl19 3'UTR GFP Stable Cell Line
TU269624	ABM	1.0 ml	Ask for price

RPL19 3'UTR GFP Stable Cell Line
TU070884	ABM	1.0 ml	EUR 1394

RPL19 3'UTR Luciferase Stable Cell Line
TU020884	ABM	1.0 ml	EUR 1394

Polyclonal Goat Anti-Ribosomal Protein L19 / RPL19 Antibody
APG00278G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Ribosomal Protein L19 / RPL19 . This antibody is tested and proven to work in the following applications:

Rabbit 60S ribosomal protein L19(RPL19) ELISA kit
E04R0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L19(RPL19) ELISA kit
E04R0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L19(RPL19) ELISA kit
E04R0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L19(RPL19) ELISA kit
E02R0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L19(RPL19) ELISA kit
E02R0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L19(RPL19) ELISA kit
E02R0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L19(RPL19) ELISA kit
E03R0441-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L19(RPL19) ELISA kit
E03R0441-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L19(RPL19) ELISA kit
E03R0441-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.