RPL19

RPL19 antibody

70R-19969 50 ul
EUR 435
Description: Rabbit polyclonal RPL19 antibody

RPL19 Antibody

DF3701 200ul
EUR 304
Description: RPL19 Antibody detects endogenous levels of total RPL19.

RPL19 Antibody

1-CSB-PA020160GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL19 Antibody

1-CSB-PA020160LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

RPL19 siRNA

20-abx904652
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL19 siRNA

20-abx931929
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL19 siRNA

20-abx931930
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL19 Antibody

ABD3701 100 ug
EUR 438

RPL19 Blocking Peptide

DF3701-BP 1mg
EUR 195

RPL19 cloning plasmid

CSB-CL020160HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 591
  • Sequence: atgagtatgctcaggcttcagaagaggctcgcctctagtgtcctccgctgtggcaagaagaaggtctggttagaccccaatgagaccaatgaaatcgccaatgccaactcccgtcagcagatccggaagctcatcaaagatgggctgatcatccgcaagcctgtgacggtccattc
  • Show more
Description: A cloning plasmid for the RPL19 gene.

anti- RPL19 antibody

FNab07419 100µg
EUR 548.75
  • Immunogen: ribosomal protein L19
  • Uniprot ID: P84098
  • Gene ID: 6143
  • Research Area: Cancer, Metabolism
Description: Antibody raised against RPL19

Anti-RPL19 antibody

PAab07419 100 ug
EUR 386

Anti-RPL19 Antibody

PB10092 100ug/vial
EUR 294

Anti-RPL19 (3H4)

YF-MA10792 100 ug
EUR 363
Description: Mouse monoclonal to RPL19

Canine RPL19 ELISA KIT

ELI-18461d 96 Tests
EUR 928

RPL19 ELISA KIT|Human

EF002576 96 Tests
EUR 689

Mouse RPL19 shRNA Plasmid

20-abx972489
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPL19 shRNA Plasmid

20-abx986701
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL19 Antibody, HRP conjugated

1-CSB-PA020160LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL19 Antibody, FITC conjugated

1-CSB-PA020160LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL19 Antibody, Biotin conjugated

1-CSB-PA020160LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL19. Recognizes RPL19 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RPL19 shRNA Plasmid

20-abx954133
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL19 Recombinant Protein (Human)

RP026896 100 ug Ask for price

RPL19 Recombinant Protein (Mouse)

RP168986 100 ug Ask for price

RPL19 Recombinant Protein (Mouse)

RP168989 100 ug Ask for price

RPL19 Recombinant Protein (Rat)

RP226625 100 ug Ask for price

Ribosomal Protein L19 (RPL19) Antibody

20-abx115230
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L19 (RPL19) Antibody

abx237419-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L19 (RPL19) Antibody

20-abx318246
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L19 (RPL19) Antibody

abx430979-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Rpl19 ORF Vector (Rat) (pORF)

ORF075543 1.0 ug DNA
EUR 506

RPL19 ORF Vector (Human) (pORF)

ORF008966 1.0 ug DNA
EUR 95

Rpl19 ORF Vector (Mouse) (pORF)

ORF056330 1.0 ug DNA
EUR 506

Rpl19 ORF Vector (Mouse) (pORF)

ORF056331 1.0 ug DNA
EUR 506

Polyclonal RPL19 antibody - C-terminal region

APR01581G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPL19 - C-terminal region. This antibody is tested and proven to work in the following applications:

Ribosomal Protein L19 (RPL19) Antibody (HRP)

20-abx315987
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L19 (RPL19) Antibody (FITC)

20-abx315988
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L19 (RPL19) Antibody (Biotin)

20-abx315989
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rpl19 sgRNA CRISPR Lentivector set (Mouse)

K4968501 3 x 1.0 ug
EUR 339

Rpl19 sgRNA CRISPR Lentivector set (Rat)

K7021901 3 x 1.0 ug
EUR 339

RPL19 sgRNA CRISPR Lentivector set (Human)

K1920301 3 x 1.0 ug
EUR 339

Anti-Ribosomal Protein L19 / RPL19 antibody

STJ70939 100 µg
EUR 359

Human Ribosomal Protein L19 (RPL19) ELISA Kit

abx382904-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Monoclonal RPL19 Antibody (monoclonal) (M01), Clone: 3H4

AMM04043G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RPL19 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3H4. This antibody is applicable in WB, IHC and IF, E

Rpl19 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4968502 1.0 ug DNA
EUR 154

Rpl19 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4968503 1.0 ug DNA
EUR 154

Rpl19 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4968504 1.0 ug DNA
EUR 154

Rpl19 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7021902 1.0 ug DNA
EUR 154

Rpl19 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7021903 1.0 ug DNA
EUR 154

Rpl19 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7021904 1.0 ug DNA
EUR 154

RPL19 sgRNA CRISPR Lentivector (Human) (Target 1)

K1920302 1.0 ug DNA
EUR 154

RPL19 sgRNA CRISPR Lentivector (Human) (Target 2)

K1920303 1.0 ug DNA
EUR 154

RPL19 sgRNA CRISPR Lentivector (Human) (Target 3)

K1920304 1.0 ug DNA
EUR 154

RPL19 Protein Vector (Rat) (pPB-C-His)

PV302170 500 ng
EUR 603

RPL19 Protein Vector (Rat) (pPB-N-His)

PV302171 500 ng
EUR 603

RPL19 Protein Vector (Rat) (pPM-C-HA)

PV302172 500 ng
EUR 603

RPL19 Protein Vector (Rat) (pPM-C-His)

PV302173 500 ng
EUR 603

RPL19 Protein Vector (Human) (pPB-C-His)

PV035861 500 ng
EUR 329

RPL19 Protein Vector (Human) (pPB-N-His)

PV035862 500 ng
EUR 329

RPL19 Protein Vector (Human) (pPM-C-HA)

PV035863 500 ng
EUR 329

RPL19 Protein Vector (Human) (pPM-C-His)

PV035864 500 ng
EUR 329

RPL19 Protein Vector (Mouse) (pPB-C-His)

PV225318 500 ng
EUR 603

RPL19 Protein Vector (Mouse) (pPB-N-His)

PV225319 500 ng
EUR 603

RPL19 Protein Vector (Mouse) (pPM-C-HA)

PV225320 500 ng
EUR 603

RPL19 Protein Vector (Mouse) (pPM-C-His)

PV225321 500 ng
EUR 603

RPL19 Protein Vector (Mouse) (pPB-C-His)

PV225322 500 ng
EUR 603

RPL19 Protein Vector (Mouse) (pPB-N-His)

PV225323 500 ng
EUR 603

RPL19 Protein Vector (Mouse) (pPM-C-HA)

PV225324 500 ng
EUR 603

RPL19 Protein Vector (Mouse) (pPM-C-His)

PV225325 500 ng
EUR 603

Rpl19 3'UTR Luciferase Stable Cell Line

TU118081 1.0 ml Ask for price

Rpl19 3'UTR GFP Stable Cell Line

TU168081 1.0 ml Ask for price

Rpl19 3'UTR Luciferase Stable Cell Line

TU219624 1.0 ml Ask for price

Rpl19 3'UTR GFP Stable Cell Line

TU269624 1.0 ml Ask for price

RPL19 3'UTR GFP Stable Cell Line

TU070884 1.0 ml
EUR 1394

RPL19 3'UTR Luciferase Stable Cell Line

TU020884 1.0 ml
EUR 1394

Polyclonal Goat Anti-Ribosomal Protein L19 / RPL19 Antibody

APG00278G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Ribosomal Protein L19 / RPL19 . This antibody is tested and proven to work in the following applications:

Rabbit 60S ribosomal protein L19(RPL19) ELISA kit

E04R0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L19(RPL19) ELISA kit

E04R0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 60S ribosomal protein L19(RPL19) ELISA kit

E04R0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L19(RPL19) ELISA kit

E02R0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L19(RPL19) ELISA kit

E02R0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S ribosomal protein L19(RPL19) ELISA kit

E02R0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L19(RPL19) ELISA kit

E03R0441-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L19(RPL19) ELISA kit

E03R0441-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 60S ribosomal protein L19(RPL19) ELISA kit

E03R0441-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 60S ribosomal protein L19(RPL19) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.