Rplp2/ Rat Rplp2 ELISA Kit
ELI-22050r	Lifescience Market	96 Tests	EUR 886

RPLP2 siRNA
20-abx904680	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPLP2 antibody
70R-33937	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPLP2 antibody

RPLP2 Antibody
34344-100ul	SAB	100ul	EUR 252

RPLP2 Antibody
34344-50ul	SAB	50ul	EUR 187

RPLP2 Antibody
42743-100ul	SAB	100ul	EUR 252

RPLP2 siRNA
20-abx932005	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPLP2 siRNA
20-abx932006	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPLP2 Antibody
1-CSB-PA558649	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

RPLP2 Antibody
1-CSB-PA040245	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPLP2 Antibody
1-CSB-PA048402	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

RPLP2 Antibody
1-CSB-PA020342DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RPLP2 Conjugated Antibody
C42743	SAB	100ul	EUR 397

RPLP2 Conjugated Antibody
C34344	SAB	100ul	EUR 397

RPLP2 cloning plasmid
CSB-CL020342HU-10ug	Cusabio	10ug	EUR 208
Formulation: 10 μg plasmid + 200μl Glycerol Length: 348 Sequence: atgcgctacgtcgcctcctacctgctggctgccctagggggcaactcctcccccagcgccaaggacatcaagaagatcttggacagcgtgggtatcgaggcggacgacgaccggctcaacaaggttatcagtgagctgaatggaaaaaacattgaagacgtcattgcccagggtat Show more
Description: A cloning plasmid for the RPLP2 gene.

RPLP2 Blocking Peptide
20-abx161426	Abbexa	EUR 606.00 EUR 1428.00	1 mg 5 mg
Shipped within 5-10 working days.

Human RPLP2 Protein
abx060053-100ug	Abbexa	100 ug	EUR 328
Shipped within 5-10 working days.

RPLP2 Rabbit pAb
A6974-100ul	Abclonal	100 ul	EUR 308

RPLP2 Rabbit pAb
A6974-200ul	Abclonal	200 ul	EUR 459

RPLP2 Rabbit pAb
A6974-20ul	Abclonal	20 ul	EUR 183

RPLP2 Rabbit pAb
A6974-50ul	Abclonal	50 ul	EUR 223

Human RPLP2 Antibody
33330-05111	AssayPro	150 ug	EUR 261

Anti-RPLP2 antibody
STJ29054	St John's Laboratory	100 µl	EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P1. The P2 protein can interact with P0 and P1 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Mouse RPLP2 shRNA Plasmid
20-abx976023	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RPLP2 shRNA Plasmid
20-abx987509	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RPLP2 shRNA Plasmid
20-abx954158	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPLP2 protein (His tag)
80R-2149	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human RPLP2 protein (His tag)

RPLP2 Recombinant Protein (Human)
RP027052	ABM	100 ug	Ask for price

RPLP2 Recombinant Protein (Rat)
RP226739	ABM	100 ug	Ask for price

RPLP2 Recombinant Protein (Mouse)
RP169136	ABM	100 ug	Ask for price

Polyclonal RPLP2 Antibody (aa21-70)
APR03021G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (aa21-70). This antibody is tested and proven to work in the following applications:

Polyclonal RPLP2 Antibody (N-Term)
APR06160G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal RPLP2 Antibody (N-Term)
APR06953G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (N-Term). This antibody is tested and proven to work in the following applications:

Human RPLP2 Antibody (Biotin Conjugate)
33330-05121	AssayPro	150 ug	EUR 369

RPLP2 ORF Vector (Human) (pORF)
ORF009018	ABM	1.0 ug DNA	EUR 95

Rplp2 ORF Vector (Mouse) (pORF)
ORF056380	ABM	1.0 ug DNA	EUR 506

Rplp2 ORF Vector (Rat) (pORF)
ORF075581	ABM	1.0 ug DNA	EUR 506

Anti-RPLP2/Ribosomal Protein Lp2 Antibody
A05244-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RPLP2/Ribosomal Protein Lp2 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Human RPLP2 AssayLite Antibody (FITC Conjugate)
33330-05141	AssayPro	150 ug	EUR 428

Human RPLP2 AssayLite Antibody (RPE Conjugate)
33330-05151	AssayPro	150 ug	EUR 428

Human RPLP2 AssayLite Antibody (APC Conjugate)
33330-05161	AssayPro	150 ug	EUR 428

Human RPLP2 AssayLite Antibody (PerCP Conjugate)
33330-05171	AssayPro	150 ug	EUR 471

RPLP2 sgRNA CRISPR Lentivector set (Human)
K1996001	ABM	3 x 1.0 ug	EUR 339

Rplp2 sgRNA CRISPR Lentivector set (Mouse)
K3175901	ABM	3 x 1.0 ug	EUR 339

Rplp2 sgRNA CRISPR Lentivector set (Rat)
K6952101	ABM	3 x 1.0 ug	EUR 339

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1996002	ABM	1.0 ug DNA	EUR 154

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1996003	ABM	1.0 ug DNA	EUR 154

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1996004	ABM	1.0 ug DNA	EUR 154

Human 60S acidic ribosomal protein P2 (RPLP2)
1-CSB-RP023544h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 38.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S acidic ribosomal protein P2(RPLP2),partial expressed in E.coli

Human 60S acidic ribosomal protein P2 (RPLP2)
1-CSB-EP020342HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 15.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S acidic ribosomal protein P2(RPLP2) expressed in E.coli

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3175902	ABM	1.0 ug DNA	EUR 154

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3175903	ABM	1.0 ug DNA	EUR 154

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3175904	ABM	1.0 ug DNA	EUR 154

RPLP2 Ribosomal Phosphoprotein P2 Human Recombinant Protein
PROTP05387	BosterBio	Regular: 20ug	EUR 317
Description: RPLP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 139 amino acids (1-115 a.a.) and having a molecular mass of 14.2kDa.;RPLP2 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6952102	ABM	1.0 ug DNA	EUR 154

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6952103	ABM	1.0 ug DNA	EUR 154

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6952104	ABM	1.0 ug DNA	EUR 154

RPLP2 Protein Vector (Human) (pPB-C-His)
PV036069	ABM	500 ng	EUR 329

RPLP2 Protein Vector (Human) (pPB-N-His)
PV036070	ABM	500 ng	EUR 329

RPLP2 Protein Vector (Human) (pPM-C-HA)
PV036071	ABM	500 ng	EUR 329

RPLP2 Protein Vector (Human) (pPM-C-His)
PV036072	ABM	500 ng	EUR 329

RPLP2 Protein Vector (Rat) (pPB-C-His)
PV302322	ABM	500 ng	EUR 603

RPLP2 Protein Vector (Rat) (pPB-N-His)
PV302323	ABM	500 ng	EUR 603

RPLP2 Protein Vector (Rat) (pPM-C-HA)
PV302324	ABM	500 ng	EUR 603

RPLP2 Protein Vector (Rat) (pPM-C-His)
PV302325	ABM	500 ng	EUR 603

RPLP2 Protein Vector (Mouse) (pPB-C-His)
PV225518	ABM	500 ng	EUR 603

RPLP2 Protein Vector (Mouse) (pPB-N-His)
PV225519	ABM	500 ng	EUR 603

RPLP2 Protein Vector (Mouse) (pPM-C-HA)
PV225520	ABM	500 ng	EUR 603

RPLP2 Protein Vector (Mouse) (pPM-C-His)
PV225521	ABM	500 ng	EUR 603

Rplp2 3'UTR GFP Stable Cell Line
TU168120	ABM	1.0 ml	Ask for price

RPLP2 3'UTR Luciferase Stable Cell Line
TU021641	ABM	1.0 ml	EUR 1394

Rplp2 3'UTR Luciferase Stable Cell Line
TU118120	ABM	1.0 ml	Ask for price

RPLP2 3'UTR GFP Stable Cell Line
TU071641	ABM	1.0 ml	EUR 1394

Rplp2 3'UTR Luciferase Stable Cell Line
TU219662	ABM	1.0 ml	Ask for price

Rplp2 3'UTR GFP Stable Cell Line
TU269662	ABM	1.0 ml	Ask for price

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody
20-abx121716	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody
abx034327-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody
abx034327-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody
20-abx005289	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody
20-abx320811	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody
20-abx326586	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody
20-abx214888	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody
20-abx241004	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RPLP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV679693	ABM	1.0 ug DNA	EUR 514

RPLP2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV679697	ABM	1.0 ug DNA	EUR 514