RPLP2

Rplp2/ Rat Rplp2 ELISA Kit

ELI-22050r 96 Tests
EUR 886

RPLP2 siRNA

20-abx904680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPLP2 antibody

70R-33937 100 ug
EUR 327
Description: Rabbit polyclonal RPLP2 antibody

RPLP2 Antibody

34344-100ul 100ul
EUR 252

RPLP2 Antibody

34344-50ul 50ul
EUR 187

RPLP2 Antibody

42743-100ul 100ul
EUR 252

RPLP2 siRNA

20-abx932005
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPLP2 siRNA

20-abx932006
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPLP2 Antibody

1-CSB-PA558649
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

RPLP2 Antibody

1-CSB-PA040245
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPLP2 Antibody

1-CSB-PA048402
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

RPLP2 Antibody

1-CSB-PA020342DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RPLP2. Recognizes RPLP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RPLP2 Conjugated Antibody

C42743 100ul
EUR 397

RPLP2 Conjugated Antibody

C34344 100ul
EUR 397

RPLP2 cloning plasmid

CSB-CL020342HU-10ug 10ug
EUR 208
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 348
  • Sequence: atgcgctacgtcgcctcctacctgctggctgccctagggggcaactcctcccccagcgccaaggacatcaagaagatcttggacagcgtgggtatcgaggcggacgacgaccggctcaacaaggttatcagtgagctgaatggaaaaaacattgaagacgtcattgcccagggtat
  • Show more
Description: A cloning plasmid for the RPLP2 gene.

RPLP2 Blocking Peptide

20-abx161426
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human RPLP2 Protein

abx060053-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

RPLP2 Rabbit pAb

A6974-100ul 100 ul
EUR 308

RPLP2 Rabbit pAb

A6974-200ul 200 ul
EUR 459

RPLP2 Rabbit pAb

A6974-20ul 20 ul
EUR 183

RPLP2 Rabbit pAb

A6974-50ul 50 ul
EUR 223

Human RPLP2 Antibody

33330-05111 150 ug
EUR 261

Anti-RPLP2 antibody

STJ29054 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P1. The P2 protein can interact with P0 and P1 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Mouse RPLP2 shRNA Plasmid

20-abx976023
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPLP2 shRNA Plasmid

20-abx987509
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPLP2 shRNA Plasmid

20-abx954158
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPLP2 protein (His tag)

80R-2149 100 ug
EUR 322
Description: Purified recombinant Human RPLP2 protein (His tag)

RPLP2 Recombinant Protein (Human)

RP027052 100 ug Ask for price

RPLP2 Recombinant Protein (Rat)

RP226739 100 ug Ask for price

RPLP2 Recombinant Protein (Mouse)

RP169136 100 ug Ask for price

Polyclonal RPLP2 Antibody (aa21-70)

APR03021G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (aa21-70). This antibody is tested and proven to work in the following applications:

Polyclonal RPLP2 Antibody (N-Term)

APR06160G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal RPLP2 Antibody (N-Term)

APR06953G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPLP2 (N-Term). This antibody is tested and proven to work in the following applications:

Human RPLP2 Antibody (Biotin Conjugate)

33330-05121 150 ug
EUR 369

RPLP2 ORF Vector (Human) (pORF)

ORF009018 1.0 ug DNA
EUR 95

Rplp2 ORF Vector (Mouse) (pORF)

ORF056380 1.0 ug DNA
EUR 506

Rplp2 ORF Vector (Rat) (pORF)

ORF075581 1.0 ug DNA
EUR 506

Anti-RPLP2/Ribosomal Protein Lp2 Antibody

A05244-1 100ul
EUR 397
Description: Rabbit Polyclonal RPLP2/Ribosomal Protein Lp2 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Human RPLP2 AssayLite Antibody (FITC Conjugate)

33330-05141 150 ug
EUR 428

Human RPLP2 AssayLite Antibody (RPE Conjugate)

33330-05151 150 ug
EUR 428

Human RPLP2 AssayLite Antibody (APC Conjugate)

33330-05161 150 ug
EUR 428

Human RPLP2 AssayLite Antibody (PerCP Conjugate)

33330-05171 150 ug
EUR 471

RPLP2 sgRNA CRISPR Lentivector set (Human)

K1996001 3 x 1.0 ug
EUR 339

Rplp2 sgRNA CRISPR Lentivector set (Mouse)

K3175901 3 x 1.0 ug
EUR 339

Rplp2 sgRNA CRISPR Lentivector set (Rat)

K6952101 3 x 1.0 ug
EUR 339

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1996002 1.0 ug DNA
EUR 154

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1996003 1.0 ug DNA
EUR 154

RPLP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1996004 1.0 ug DNA
EUR 154

Human 60S acidic ribosomal protein P2 (RPLP2)

1-CSB-RP023544h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S acidic ribosomal protein P2(RPLP2),partial expressed in E.coli

Human 60S acidic ribosomal protein P2 (RPLP2)

1-CSB-EP020342HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 15.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S acidic ribosomal protein P2(RPLP2) expressed in E.coli

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3175902 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3175903 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3175904 1.0 ug DNA
EUR 154

RPLP2 Ribosomal Phosphoprotein P2 Human Recombinant Protein

PROTP05387 Regular: 20ug
EUR 317
Description: RPLP2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 139 amino acids (1-115 a.a.) and having a molecular mass of 14.2kDa.;RPLP2 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6952102 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6952103 1.0 ug DNA
EUR 154

Rplp2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6952104 1.0 ug DNA
EUR 154

RPLP2 Protein Vector (Human) (pPB-C-His)

PV036069 500 ng
EUR 329

RPLP2 Protein Vector (Human) (pPB-N-His)

PV036070 500 ng
EUR 329

RPLP2 Protein Vector (Human) (pPM-C-HA)

PV036071 500 ng
EUR 329

RPLP2 Protein Vector (Human) (pPM-C-His)

PV036072 500 ng
EUR 329

RPLP2 Protein Vector (Rat) (pPB-C-His)

PV302322 500 ng
EUR 603

RPLP2 Protein Vector (Rat) (pPB-N-His)

PV302323 500 ng
EUR 603

RPLP2 Protein Vector (Rat) (pPM-C-HA)

PV302324 500 ng
EUR 603

RPLP2 Protein Vector (Rat) (pPM-C-His)

PV302325 500 ng
EUR 603

RPLP2 Protein Vector (Mouse) (pPB-C-His)

PV225518 500 ng
EUR 603

RPLP2 Protein Vector (Mouse) (pPB-N-His)

PV225519 500 ng
EUR 603

RPLP2 Protein Vector (Mouse) (pPM-C-HA)

PV225520 500 ng
EUR 603

RPLP2 Protein Vector (Mouse) (pPM-C-His)

PV225521 500 ng
EUR 603

Rplp2 3'UTR GFP Stable Cell Line

TU168120 1.0 ml Ask for price

RPLP2 3'UTR Luciferase Stable Cell Line

TU021641 1.0 ml
EUR 1394

Rplp2 3'UTR Luciferase Stable Cell Line

TU118120 1.0 ml Ask for price

RPLP2 3'UTR GFP Stable Cell Line

TU071641 1.0 ml
EUR 1394

Rplp2 3'UTR Luciferase Stable Cell Line

TU219662 1.0 ml Ask for price

Rplp2 3'UTR GFP Stable Cell Line

TU269662 1.0 ml Ask for price

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody

20-abx121716
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody

abx034327-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody

abx034327-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody

20-abx005289
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody

20-abx320811
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody

20-abx326586
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody

20-abx214888
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P2 (RPLP2) Antibody

20-abx241004
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RPLP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV679693 1.0 ug DNA
EUR 514

RPLP2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV679697 1.0 ug DNA
EUR 514