CBX2 siRNA
20-abx910428	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CBX2 siRNA
20-abx910429	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CBX2 Antibody
31050-100ul	SAB	100ul	EUR 252

CBX2 Antibody
31050-50ul	SAB	50ul	EUR 187

CBX2 Antibody
DF9380	Affbiotech	200ul	EUR 304
Description: CBX2 Antibody detects endogenous levels of total CBX2.

CBX2 Antibody
1-CSB-PA613521LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CBX2 Antibody
1-CSB-PA042961	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

CBX2 Antibody
1-CSB-PA070046	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

CBX2 Conjugated Antibody
C31050	SAB	100ul	EUR 397

CBX2 cloning plasmid
CSB-CL613521HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 636 Sequence: atggaggagctgagcagcgtgggcgagcaggtcttcgccgccgagtgcatcctgagcaagcggctccgcaagggcaagctggagtacctggtcaagtggcgcggctggtcctccaaacataacagctgggagccggaggagaacatcctggacccgaggctgctcctggccttcca Show more
Description: A cloning plasmid for the CBX2 gene.

anti- CBX2 antibody
FNab01329	FN Test	100µg	EUR 505.25
Immunogen: chromobox homolog 2(Pc class homolog, Drosophila) Uniprot ID: Q14781 Gene ID: 84733 Research Area: Stem Cells, Metabolism
Description: Antibody raised against CBX2

CBX2 Polyclonal Antibody
ES7779-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CBX2 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

CBX2 Polyclonal Antibody
ES7779-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CBX2 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

CBX2 Polyclonal Antibody
ABP56780-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2 Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody
ABP56780-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2 Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody
ABP56780-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2 Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody
A58442	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

CBX2 Rabbit pAb
A2683-100ul	Abclonal	100 ul	EUR 308

CBX2 Rabbit pAb
A2683-200ul	Abclonal	200 ul	EUR 459

CBX2 Rabbit pAb
A2683-20ul	Abclonal	20 ul	EUR 183

CBX2 Rabbit pAb
A2683-50ul	Abclonal	50 ul	EUR 223

CBX2 polyclonal antibody
6840-50	Biovision		EUR 251

CBX2 Blocking Peptide
DF9380-BP	Affbiotech	1mg	EUR 195

Anti-CBX2 antibody
PAab01329	Lifescience Market	100 ug	EUR 355

Anti-CBX2 antibody
STJ92063	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to CBX2.

Anti-CBX2 antibody
STJ111164	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in mice results in male-to-female gonadal sex reversal. Mutations in this gene are also associated with gonadal dysgenesis in humans. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Anti-CBX2 (3E2)
YF-MA19571	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CBX2

Anti-CBX2 (1E9)
YF-MA20596	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CBX2

Human CBX2 shRNA Plasmid
20-abx963604	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CBX2 ELISA KIT|Human
EF008422	Lifescience Market	96 Tests	EUR 689

Chromobox 2 (CBX2) Antibody
20-abx325256	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Chromobox 2 (CBX2) Antibody
20-abx212367	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mouse CBX2 shRNA Plasmid
20-abx969513	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CBX2 Antibody, HRP conjugated
1-CSB-PA613521LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CBX2 Antibody, FITC conjugated
1-CSB-PA613521LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CBX2 Antibody, Biotin conjugated
1-CSB-PA613521LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CBX2 Recombinant Protein (Human)
RP005752	ABM	100 ug	Ask for price

pcDNA6-Flag-CBX2 Plasmid
PVTB00735-2a	Lifescience Market	2 ug	EUR 356

CBX2 Recombinant Protein (Rat)
RP193319	ABM	100 ug	Ask for price

CBX2 Recombinant Protein (Mouse)
RP121445	ABM	100 ug	Ask for price

Chromobox Homolog 2 (CBX2) Antibody
abx146269-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody
20-abx135729	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody
abx034438-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody
abx034438-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody
abx029317-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody
abx029317-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody
abx016180-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody
abx224211-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody
abx231329-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

CBX2 Polyclonal Antibody, Biotin Conjugated
A58443	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

CBX2 Polyclonal Antibody, FITC Conjugated
A58444	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CBX2 Polyclonal Antibody, HRP Conjugated
A58445	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

CBX2 ORF Vector (Human) (pORF)
ORF001918	ABM	1.0 ug DNA	EUR 95

Cbx2 ORF Vector (Mouse) (pORF)
ORF040483	ABM	1.0 ug DNA	EUR 506

Cbx2 ORF Vector (Rat) (pORF)
ORF064441	ABM	1.0 ug DNA	EUR 506

CBX2 sgRNA CRISPR Lentivector set (Human)
K0370601	ABM	3 x 1.0 ug	EUR 339

Chromobox Protein Homolog 2 (CBX2) Antibody
20-abx318377	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cbx2 sgRNA CRISPR Lentivector set (Mouse)
K4381901	ABM	3 x 1.0 ug	EUR 339

Cbx2 sgRNA CRISPR Lentivector set (Rat)
K7569601	ABM	3 x 1.0 ug	EUR 339

CBX2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0370602	ABM	1.0 ug DNA	EUR 154

CBX2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0370603	ABM	1.0 ug DNA	EUR 154

CBX2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0370604	ABM	1.0 ug DNA	EUR 154

Chromobox Protein Homolog 2 (CBX2) Antibody (HRP)
20-abx306766	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Chromobox Protein Homolog 2 (CBX2) Antibody (FITC)
20-abx306767	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Chromobox Protein Homolog 2 (CBX2) Antibody (Biotin)
20-abx306768	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Chromobox Homolog 2 (CBX2) ELISA Kit
20-abx386316	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Chromobox Homolog 2 (CBX2)ELISA Kit
201-12-2895	SunredBio	96 tests	EUR 440
This Chromobox Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4381902	ABM	1.0 ug DNA	EUR 154

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4381903	ABM	1.0 ug DNA	EUR 154

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4381904	ABM	1.0 ug DNA	EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7569602	ABM	1.0 ug DNA	EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7569603	ABM	1.0 ug DNA	EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7569604	ABM	1.0 ug DNA	EUR 154

Human Chromobox Homolog 2(CBX2)ELISA Kit
QY-E01795	Qayee Biotechnology	96T	EUR 361

CBX2 Protein Vector (Human) (pPB-C-His)
PV007669	ABM	500 ng	EUR 329

CBX2 Protein Vector (Human) (pPB-N-His)
PV007670	ABM	500 ng	EUR 329

CBX2 Protein Vector (Human) (pPM-C-HA)
PV007671	ABM	500 ng	EUR 329

CBX2 Protein Vector (Human) (pPM-C-His)
PV007672	ABM	500 ng	EUR 329

CBX2 Protein Vector (Rat) (pPB-C-His)
PV257762	ABM	500 ng	EUR 603

CBX2 Protein Vector (Rat) (pPB-N-His)
PV257763	ABM	500 ng	EUR 603

CBX2 Protein Vector (Rat) (pPM-C-HA)
PV257764	ABM	500 ng	EUR 603

CBX2 Protein Vector (Rat) (pPM-C-His)
PV257765	ABM	500 ng	EUR 603

CBX2 Protein Vector (Mouse) (pPB-C-His)
PV161930	ABM	500 ng	EUR 603

CBX2 Protein Vector (Mouse) (pPB-N-His)
PV161931	ABM	500 ng	EUR 603

CBX2 Protein Vector (Mouse) (pPM-C-HA)
PV161932	ABM	500 ng	EUR 603

CBX2 Protein Vector (Mouse) (pPM-C-His)
PV161933	ABM	500 ng	EUR 603

Cbx2 3'UTR Luciferase Stable Cell Line
TU201721	ABM	1.0 ml	Ask for price

Cbx2 3'UTR GFP Stable Cell Line
TU153200	ABM	1.0 ml	Ask for price

CBX2 3'UTR Luciferase Stable Cell Line
TU003562	ABM	1.0 ml	EUR 1521

Cbx2 3'UTR Luciferase Stable Cell Line
TU103200	ABM	1.0 ml	Ask for price