CBX2

CBX2 siRNA

20-abx910428
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CBX2 siRNA

20-abx910429
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CBX2 Antibody

31050-100ul 100ul
EUR 252

CBX2 Antibody

31050-50ul 50ul
EUR 187

CBX2 Antibody

DF9380 200ul
EUR 304
Description: CBX2 Antibody detects endogenous levels of total CBX2.

CBX2 Antibody

1-CSB-PA613521LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CBX2 Antibody

1-CSB-PA042961
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

CBX2 Antibody

1-CSB-PA070046
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

CBX2 Conjugated Antibody

C31050 100ul
EUR 397

CBX2 cloning plasmid

CSB-CL613521HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 636
  • Sequence: atggaggagctgagcagcgtgggcgagcaggtcttcgccgccgagtgcatcctgagcaagcggctccgcaagggcaagctggagtacctggtcaagtggcgcggctggtcctccaaacataacagctgggagccggaggagaacatcctggacccgaggctgctcctggccttcca
  • Show more
Description: A cloning plasmid for the CBX2 gene.

anti- CBX2 antibody

FNab01329 100µg
EUR 505.25
  • Immunogen: chromobox homolog 2(Pc class homolog, Drosophila)
  • Uniprot ID: Q14781
  • Gene ID: 84733
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against CBX2

CBX2 Polyclonal Antibody

ES7779-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CBX2 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

CBX2 Polyclonal Antibody

ES7779-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CBX2 from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

CBX2 Polyclonal Antibody

ABP56780-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2
  • Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody

ABP56780-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2
  • Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody

ABP56780-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human CBX2
  • Applications tips:
Description: A polyclonal antibody for detection of CBX2 from Human, Mouse. This CBX2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human CBX2

CBX2 Polyclonal Antibody

A58442 100 µg
EUR 570.55
Description: Ask the seller for details

CBX2 Rabbit pAb

A2683-100ul 100 ul
EUR 308

CBX2 Rabbit pAb

A2683-200ul 200 ul
EUR 459

CBX2 Rabbit pAb

A2683-20ul 20 ul
EUR 183

CBX2 Rabbit pAb

A2683-50ul 50 ul
EUR 223

CBX2 polyclonal antibody

6840-50
EUR 251

CBX2 Blocking Peptide

DF9380-BP 1mg
EUR 195

Anti-CBX2 antibody

PAab01329 100 ug
EUR 355

Anti-CBX2 antibody

STJ92063 200 µl
EUR 197
Description: Rabbit polyclonal to CBX2.

Anti-CBX2 antibody

STJ111164 100 µl
EUR 277
Description: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in mice results in male-to-female gonadal sex reversal. Mutations in this gene are also associated with gonadal dysgenesis in humans. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Anti-CBX2 (3E2)

YF-MA19571 100 ug
EUR 363
Description: Mouse monoclonal to CBX2

Anti-CBX2 (1E9)

YF-MA20596 100 ug
EUR 363
Description: Mouse monoclonal to CBX2

Human CBX2 shRNA Plasmid

20-abx963604
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CBX2 ELISA KIT|Human

EF008422 96 Tests
EUR 689

Chromobox 2 (CBX2) Antibody

20-abx325256
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chromobox 2 (CBX2) Antibody

20-abx212367
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse CBX2 shRNA Plasmid

20-abx969513
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CBX2 Antibody, HRP conjugated

1-CSB-PA613521LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CBX2 Antibody, FITC conjugated

1-CSB-PA613521LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CBX2 Antibody, Biotin conjugated

1-CSB-PA613521LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX2. Recognizes CBX2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CBX2 Recombinant Protein (Human)

RP005752 100 ug Ask for price

pcDNA6-Flag-CBX2 Plasmid

PVTB00735-2a 2 ug
EUR 356

CBX2 Recombinant Protein (Rat)

RP193319 100 ug Ask for price

CBX2 Recombinant Protein (Mouse)

RP121445 100 ug Ask for price

Chromobox Homolog 2 (CBX2) Antibody

abx146269-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

20-abx135729
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx034438-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx034438-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx029317-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx029317-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx016180-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx224211-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Chromobox Homolog 2 (CBX2) Antibody

abx231329-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CBX2 Polyclonal Antibody, Biotin Conjugated

A58443 100 µg
EUR 570.55
Description: The best epigenetics products

CBX2 Polyclonal Antibody, FITC Conjugated

A58444 100 µg
EUR 570.55
Description: kits suitable for this type of research

CBX2 Polyclonal Antibody, HRP Conjugated

A58445 100 µg
EUR 570.55
Description: fast delivery possible

CBX2 ORF Vector (Human) (pORF)

ORF001918 1.0 ug DNA
EUR 95

Cbx2 ORF Vector (Mouse) (pORF)

ORF040483 1.0 ug DNA
EUR 506

Cbx2 ORF Vector (Rat) (pORF)

ORF064441 1.0 ug DNA
EUR 506

CBX2 sgRNA CRISPR Lentivector set (Human)

K0370601 3 x 1.0 ug
EUR 339

Chromobox Protein Homolog 2 (CBX2) Antibody

20-abx318377
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cbx2 sgRNA CRISPR Lentivector set (Mouse)

K4381901 3 x 1.0 ug
EUR 339

Cbx2 sgRNA CRISPR Lentivector set (Rat)

K7569601 3 x 1.0 ug
EUR 339

CBX2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0370602 1.0 ug DNA
EUR 154

CBX2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0370603 1.0 ug DNA
EUR 154

CBX2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0370604 1.0 ug DNA
EUR 154

Chromobox Protein Homolog 2 (CBX2) Antibody (HRP)

20-abx306766
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 2 (CBX2) Antibody (FITC)

20-abx306767
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 2 (CBX2) Antibody (Biotin)

20-abx306768
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Chromobox Homolog 2 (CBX2) ELISA Kit

20-abx386316
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Chromobox Homolog 2 (CBX2)ELISA Kit

201-12-2895 96 tests
EUR 440
  • This Chromobox Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4381902 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4381903 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4381904 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7569602 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7569603 1.0 ug DNA
EUR 154

Cbx2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7569604 1.0 ug DNA
EUR 154

Human Chromobox Homolog 2(CBX2)ELISA Kit

QY-E01795 96T
EUR 361

CBX2 Protein Vector (Human) (pPB-C-His)

PV007669 500 ng
EUR 329

CBX2 Protein Vector (Human) (pPB-N-His)

PV007670 500 ng
EUR 329

CBX2 Protein Vector (Human) (pPM-C-HA)

PV007671 500 ng
EUR 329

CBX2 Protein Vector (Human) (pPM-C-His)

PV007672 500 ng
EUR 329

CBX2 Protein Vector (Rat) (pPB-C-His)

PV257762 500 ng
EUR 603

CBX2 Protein Vector (Rat) (pPB-N-His)

PV257763 500 ng
EUR 603

CBX2 Protein Vector (Rat) (pPM-C-HA)

PV257764 500 ng
EUR 603

CBX2 Protein Vector (Rat) (pPM-C-His)

PV257765 500 ng
EUR 603

CBX2 Protein Vector (Mouse) (pPB-C-His)

PV161930 500 ng
EUR 603

CBX2 Protein Vector (Mouse) (pPB-N-His)

PV161931 500 ng
EUR 603

CBX2 Protein Vector (Mouse) (pPM-C-HA)

PV161932 500 ng
EUR 603

CBX2 Protein Vector (Mouse) (pPM-C-His)

PV161933 500 ng
EUR 603

Cbx2 3'UTR Luciferase Stable Cell Line

TU201721 1.0 ml Ask for price

Cbx2 3'UTR GFP Stable Cell Line

TU153200 1.0 ml Ask for price

CBX2 3'UTR Luciferase Stable Cell Line

TU003562 1.0 ml
EUR 1521

Cbx2 3'UTR Luciferase Stable Cell Line

TU103200 1.0 ml Ask for price