NAGK

NAGK siRNA

20-abx903460
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAGK siRNA

20-abx925353
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAGK siRNA

20-abx925354
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAGK antibody

10R-8328 50 ul
EUR 246
Description: Mouse monoclonal NAGK antibody

NAGK antibody

70R-18742 50 ul
EUR 435
Description: Rabbit polyclonal NAGK antibody

NAGK Antibody

1-CSB-PA883457HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

NAGK Antibody

1-CSB-PA015415GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

pOTB7-NAGK

PVT18967 2 ug
EUR 231

anti- NAGK antibody

FNab05538 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: N-acetylglucosamine kinase
  • Uniprot ID: Q9UJ70
  • Gene ID: 55577
  • Research Area: Signal Transduction, Metabolism, Cell Division and Proliferation
Description: Antibody raised against NAGK

NAGK Polyclonal Antibody

A56735 100 µg
EUR 570.55
Description: The best epigenetics products

NAGK Rabbit pAb

A9070-100ul 100 ul
EUR 308

NAGK Rabbit pAb

A9070-200ul 200 ul
EUR 459

NAGK Rabbit pAb

A9070-20ul 20 ul
EUR 183

NAGK Rabbit pAb

A9070-50ul 50 ul
EUR 223

NAGK Polyclonal Antibody

31664-100ul 100ul
EUR 252

NAGK Polyclonal Antibody

31664-50ul 50ul
EUR 187

NAGK cloning plasmid

CSB-CL883457HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atggccgcgatctatgggggtgtagaggggggaggcacacgatccgaggtccttttagtctcagaggatgggaagatcctggcagaagcagatggactgagcacaaaccactggctgatcgggacagacaagtgtgtggagaggatcaatgagatggtgaacagggccaaacgga
  • Show more
Description: A cloning plasmid for the NAGK gene.

NAGK cloning plasmid

CSB-CL883457HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atggccgcgatctatgggggtgtagaggggggaggcacacgatccgaggtccttttagtctcagaggatgggaagatcctggcagaagcagatggactgagcacaaaccacaggctgatcgggacagacaagtgtgtggagaggatcaatgagatggtgaacagggccaaacgga
  • Show more
Description: A cloning plasmid for the NAGK gene.

Anti-NAGK antibody

PAab05538 100 ug
EUR 386

Anti-NAGK antibody

STJ111552 100 µl
EUR 277
Description: This gene encodes a member of the N-acetylhexosamine kinase family. The encoded protein catalyzes the conversion of N-acetyl-D-glucosamine to N-acetyl-D-glucosamine 6-phosphate, and is the major mammalian enzyme which recovers amino sugars.

NAGK Polyclonal Conjugated Antibody

C31664 100ul
EUR 397

Mouse NAGK shRNA Plasmid

20-abx974627
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NAGK shRNA Plasmid

20-abx988850
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NAGK ELISA KIT|Human

EF001073 96 Tests
EUR 689

NAGK protein (His tag)

80R-2217 100 ug
EUR 322
Description: Purified recombinant Human NAGK Protein (His tag)

Human NAGK shRNA Plasmid

20-abx960748
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NAGK Antibody, HRP conjugated

1-CSB-PA883457HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAGK Antibody, FITC conjugated

1-CSB-PA883457HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAGK Antibody, Biotin conjugated

1-CSB-PA883457HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NAGK Recombinant Protein (Human)

RP020629 100 ug Ask for price

NAGK Recombinant Protein (Human)

RP020632 100 ug Ask for price

NAGK Recombinant Protein (Rat)

RP213215 100 ug Ask for price

NAGK Recombinant Protein (Mouse)

RP152993 100 ug Ask for price

NAGK Recombinant Protein (Mouse)

RP152996 100 ug Ask for price

NAGK Polyclonal Antibody, HRP Conjugated

A56736 100 µg
EUR 570.55
Description: kits suitable for this type of research

NAGK Polyclonal Antibody, FITC Conjugated

A56737 100 µg
EUR 570.55
Description: fast delivery possible

NAGK Polyclonal Antibody, Biotin Conjugated

A56738 100 µg
EUR 570.55
Description: reagents widely cited

NAGK ORF Vector (Human) (pORF)

ORF006877 1.0 ug DNA
EUR 95

NAGK ORF Vector (Human) (pORF)

ORF006878 1.0 ug DNA
EUR 95

Nagk ORF Vector (Rat) (pORF)

ORF071073 1.0 ug DNA
EUR 506

Nagk ORF Vector (Mouse) (pORF)

ORF050999 1.0 ug DNA
EUR 506

Nagk ORF Vector (Mouse) (pORF)

ORF051000 1.0 ug DNA
EUR 506

NAGK ELISA Kit (Rat) (OKCA00984)

OKCA00984 96 Wells
EUR 833
Description: Description of target: Converts endogenous N-acetylglucosamine (GlcNAc), a major component of complex carbohydrates, from lysosomal degradation or nutritional sources into GlcNAc 6-phosphate. Involved in the N-glycolylneuraminic acid (Neu5Gc) degradation pathway. Also has ManNAc kinase activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

NAGK sgRNA CRISPR Lentivector set (Human)

K1387101 3 x 1.0 ug
EUR 339

Nagk sgRNA CRISPR Lentivector set (Mouse)

K3232001 3 x 1.0 ug
EUR 339

Nagk sgRNA CRISPR Lentivector set (Rat)

K7477001 3 x 1.0 ug
EUR 339

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody

20-abx123697
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody

20-abx113974
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody

20-abx137267
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody

20-abx311735
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody

abx235538-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NAGK sgRNA CRISPR Lentivector (Human) (Target 1)

K1387102 1.0 ug DNA
EUR 154

NAGK sgRNA CRISPR Lentivector (Human) (Target 2)

K1387103 1.0 ug DNA
EUR 154

NAGK sgRNA CRISPR Lentivector (Human) (Target 3)

K1387104 1.0 ug DNA
EUR 154

Human N-acetyl-D-glucosamine kinase (NAGK)

1-CSB-EP883457HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human N-acetyl-D-glucosamine kinase(NAGK) expressed in E.coli

Nagk sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3232002 1.0 ug DNA
EUR 154

Nagk sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3232003 1.0 ug DNA
EUR 154

Nagk sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3232004 1.0 ug DNA
EUR 154

Nagk sgRNA CRISPR Lentivector (Rat) (Target 1)

K7477002 1.0 ug DNA
EUR 154

Nagk sgRNA CRISPR Lentivector (Rat) (Target 2)

K7477003 1.0 ug DNA
EUR 154

Nagk sgRNA CRISPR Lentivector (Rat) (Target 3)

K7477004 1.0 ug DNA
EUR 154

NAGK N-Acetylglucosamine Kinase Human Recombinant Protein

PROTQ9UJ70 Regular: 20ug
EUR 317
Description: NAGK Human Recombinant produced in E. coli is a single polypeptide chain containing 367 amino acids (1-344) and having a molecular mass of 39.8kDa.;NAGK is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human N-Acetylglucosamine Kinase(NAGK)ELISA Kit

QY-E04730 96T
EUR 361

NAGK Protein Vector (Rat) (pPB-C-His)

PV284290 500 ng
EUR 603

NAGK Protein Vector (Rat) (pPB-N-His)

PV284291 500 ng
EUR 603

NAGK Protein Vector (Rat) (pPM-C-HA)

PV284292 500 ng
EUR 603

NAGK Protein Vector (Rat) (pPM-C-His)

PV284293 500 ng
EUR 603

NAGK Protein Vector (Human) (pPB-C-His)

PV027505 500 ng
EUR 329

NAGK Protein Vector (Human) (pPB-N-His)

PV027506 500 ng
EUR 329

NAGK Protein Vector (Human) (pPM-C-HA)

PV027507 500 ng
EUR 329

NAGK Protein Vector (Human) (pPM-C-His)

PV027508 500 ng
EUR 329

NAGK Protein Vector (Human) (pPB-C-His)

PV027509 500 ng
EUR 329

NAGK Protein Vector (Human) (pPB-N-His)

PV027510 500 ng
EUR 329

NAGK Protein Vector (Human) (pPM-C-HA)

PV027511 500 ng
EUR 329

NAGK Protein Vector (Human) (pPM-C-His)

PV027512 500 ng
EUR 329

NAGK Protein Vector (Mouse) (pPB-C-His)

PV203994 500 ng
EUR 603

NAGK Protein Vector (Mouse) (pPB-N-His)

PV203995 500 ng
EUR 603

NAGK Protein Vector (Mouse) (pPM-C-HA)

PV203996 500 ng
EUR 603

NAGK Protein Vector (Mouse) (pPM-C-His)

PV203997 500 ng
EUR 603

NAGK Protein Vector (Mouse) (pPB-C-His)

PV203998 500 ng
EUR 603

NAGK Protein Vector (Mouse) (pPB-N-His)

PV203999 500 ng
EUR 603

NAGK Protein Vector (Mouse) (pPM-C-HA)

PV204000 500 ng
EUR 603

NAGK Protein Vector (Mouse) (pPM-C-His)

PV204001 500 ng
EUR 603

Nagk 3'UTR GFP Stable Cell Line

TU163811 1.0 ml Ask for price

Nagk 3'UTR Luciferase Stable Cell Line

TU213721 1.0 ml Ask for price

NAGK 3'UTR Luciferase Stable Cell Line

TU015187 1.0 ml
EUR 2333

Nagk 3'UTR Luciferase Stable Cell Line

TU113811 1.0 ml Ask for price

NAGK 3'UTR GFP Stable Cell Line

TU065187 1.0 ml
EUR 2333

Nagk 3'UTR GFP Stable Cell Line

TU263721 1.0 ml Ask for price

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody (HRP)

20-abx311736
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody (FITC)

20-abx311737
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody (Biotin)

20-abx311738
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NAGK Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV656575 1.0 ug DNA
EUR 682

NAGK Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV656579 1.0 ug DNA
EUR 682

NAGK Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV656580 1.0 ug DNA
EUR 682