NAGK siRNA
20-abx903460	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NAGK siRNA
20-abx925353	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NAGK siRNA
20-abx925354	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NAGK antibody
10R-8328	Fitzgerald	50 ul	EUR 246
Description: Mouse monoclonal NAGK antibody

NAGK antibody
70R-18742	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NAGK antibody

NAGK Antibody
1-CSB-PA883457HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

NAGK Antibody
1-CSB-PA015415GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

pOTB7-NAGK
PVT18967	Lifescience Market	2 ug	EUR 231

anti- NAGK antibody
FNab05538	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 IF: 1:50-1:500 Immunogen: N-acetylglucosamine kinase Uniprot ID: Q9UJ70 Gene ID: 55577 Research Area: Signal Transduction, Metabolism, Cell Division and Proliferation
Description: Antibody raised against NAGK

NAGK Polyclonal Antibody
A56735	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NAGK Rabbit pAb
A9070-100ul	Abclonal	100 ul	EUR 308

NAGK Rabbit pAb
A9070-200ul	Abclonal	200 ul	EUR 459

NAGK Rabbit pAb
A9070-20ul	Abclonal	20 ul	EUR 183

NAGK Rabbit pAb
A9070-50ul	Abclonal	50 ul	EUR 223

NAGK Polyclonal Antibody
31664-100ul	SAB	100ul	EUR 252

NAGK Polyclonal Antibody
31664-50ul	SAB	50ul	EUR 187

NAGK cloning plasmid
CSB-CL883457HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1035 Sequence: atggccgcgatctatgggggtgtagaggggggaggcacacgatccgaggtccttttagtctcagaggatgggaagatcctggcagaagcagatggactgagcacaaaccactggctgatcgggacagacaagtgtgtggagaggatcaatgagatggtgaacagggccaaacgga Show more
Description: A cloning plasmid for the NAGK gene.

NAGK cloning plasmid
CSB-CL883457HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1035 Sequence: atggccgcgatctatgggggtgtagaggggggaggcacacgatccgaggtccttttagtctcagaggatgggaagatcctggcagaagcagatggactgagcacaaaccacaggctgatcgggacagacaagtgtgtggagaggatcaatgagatggtgaacagggccaaacgga Show more
Description: A cloning plasmid for the NAGK gene.

Anti-NAGK antibody
PAab05538	Lifescience Market	100 ug	EUR 386

Anti-NAGK antibody
STJ111552	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the N-acetylhexosamine kinase family. The encoded protein catalyzes the conversion of N-acetyl-D-glucosamine to N-acetyl-D-glucosamine 6-phosphate, and is the major mammalian enzyme which recovers amino sugars.

NAGK Polyclonal Conjugated Antibody
C31664	SAB	100ul	EUR 397

Mouse NAGK shRNA Plasmid
20-abx974627	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NAGK shRNA Plasmid
20-abx988850	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NAGK ELISA KIT|Human
EF001073	Lifescience Market	96 Tests	EUR 689

NAGK protein (His tag)
80R-2217	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human NAGK Protein (His tag)

Human NAGK shRNA Plasmid
20-abx960748	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NAGK Antibody, HRP conjugated
1-CSB-PA883457HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAGK Antibody, FITC conjugated
1-CSB-PA883457HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAGK Antibody, Biotin conjugated
1-CSB-PA883457HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAGK. Recognizes NAGK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NAGK Recombinant Protein (Human)
RP020629	ABM	100 ug	Ask for price

NAGK Recombinant Protein (Human)
RP020632	ABM	100 ug	Ask for price

NAGK Recombinant Protein (Rat)
RP213215	ABM	100 ug	Ask for price

NAGK Recombinant Protein (Mouse)
RP152993	ABM	100 ug	Ask for price

NAGK Recombinant Protein (Mouse)
RP152996	ABM	100 ug	Ask for price

NAGK Polyclonal Antibody, HRP Conjugated
A56736	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NAGK Polyclonal Antibody, FITC Conjugated
A56737	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

NAGK Polyclonal Antibody, Biotin Conjugated
A56738	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NAGK ORF Vector (Human) (pORF)
ORF006877	ABM	1.0 ug DNA	EUR 95

NAGK ORF Vector (Human) (pORF)
ORF006878	ABM	1.0 ug DNA	EUR 95

Nagk ORF Vector (Rat) (pORF)
ORF071073	ABM	1.0 ug DNA	EUR 506

Nagk ORF Vector (Mouse) (pORF)
ORF050999	ABM	1.0 ug DNA	EUR 506

Nagk ORF Vector (Mouse) (pORF)
ORF051000	ABM	1.0 ug DNA	EUR 506

NAGK ELISA Kit (Rat) (OKCA00984)
OKCA00984	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Converts endogenous N-acetylglucosamine (GlcNAc), a major component of complex carbohydrates, from lysosomal degradation or nutritional sources into GlcNAc 6-phosphate. Involved in the N-glycolylneuraminic acid (Neu5Gc) degradation pathway. Also has ManNAc kinase activity.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

NAGK sgRNA CRISPR Lentivector set (Human)
K1387101	ABM	3 x 1.0 ug	EUR 339

Nagk sgRNA CRISPR Lentivector set (Mouse)
K3232001	ABM	3 x 1.0 ug	EUR 339

Nagk sgRNA CRISPR Lentivector set (Rat)
K7477001	ABM	3 x 1.0 ug	EUR 339

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody
20-abx123697	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody
20-abx113974	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody
20-abx137267	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody
20-abx311735	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody
abx235538-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

NAGK sgRNA CRISPR Lentivector (Human) (Target 1)
K1387102	ABM	1.0 ug DNA	EUR 154

NAGK sgRNA CRISPR Lentivector (Human) (Target 2)
K1387103	ABM	1.0 ug DNA	EUR 154

NAGK sgRNA CRISPR Lentivector (Human) (Target 3)
K1387104	ABM	1.0 ug DNA	EUR 154

Human N-acetyl-D-glucosamine kinase (NAGK)
1-CSB-EP883457HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 53.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human N-acetyl-D-glucosamine kinase(NAGK) expressed in E.coli

Nagk sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3232002	ABM	1.0 ug DNA	EUR 154

Nagk sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3232003	ABM	1.0 ug DNA	EUR 154

Nagk sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3232004	ABM	1.0 ug DNA	EUR 154

Nagk sgRNA CRISPR Lentivector (Rat) (Target 1)
K7477002	ABM	1.0 ug DNA	EUR 154

Nagk sgRNA CRISPR Lentivector (Rat) (Target 2)
K7477003	ABM	1.0 ug DNA	EUR 154

Nagk sgRNA CRISPR Lentivector (Rat) (Target 3)
K7477004	ABM	1.0 ug DNA	EUR 154

NAGK N-Acetylglucosamine Kinase Human Recombinant Protein
PROTQ9UJ70	BosterBio	Regular: 20ug	EUR 317
Description: NAGK Human Recombinant produced in E. coli is a single polypeptide chain containing 367 amino acids (1-344) and having a molecular mass of 39.8kDa.;NAGK is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human N-Acetylglucosamine Kinase(NAGK)ELISA Kit
QY-E04730	Qayee Biotechnology	96T	EUR 361

NAGK Protein Vector (Rat) (pPB-C-His)
PV284290	ABM	500 ng	EUR 603

NAGK Protein Vector (Rat) (pPB-N-His)
PV284291	ABM	500 ng	EUR 603

NAGK Protein Vector (Rat) (pPM-C-HA)
PV284292	ABM	500 ng	EUR 603

NAGK Protein Vector (Rat) (pPM-C-His)
PV284293	ABM	500 ng	EUR 603

NAGK Protein Vector (Human) (pPB-C-His)
PV027505	ABM	500 ng	EUR 329

NAGK Protein Vector (Human) (pPB-N-His)
PV027506	ABM	500 ng	EUR 329

NAGK Protein Vector (Human) (pPM-C-HA)
PV027507	ABM	500 ng	EUR 329

NAGK Protein Vector (Human) (pPM-C-His)
PV027508	ABM	500 ng	EUR 329

NAGK Protein Vector (Human) (pPB-C-His)
PV027509	ABM	500 ng	EUR 329

NAGK Protein Vector (Human) (pPB-N-His)
PV027510	ABM	500 ng	EUR 329

NAGK Protein Vector (Human) (pPM-C-HA)
PV027511	ABM	500 ng	EUR 329

NAGK Protein Vector (Human) (pPM-C-His)
PV027512	ABM	500 ng	EUR 329

NAGK Protein Vector (Mouse) (pPB-C-His)
PV203994	ABM	500 ng	EUR 603

NAGK Protein Vector (Mouse) (pPB-N-His)
PV203995	ABM	500 ng	EUR 603

NAGK Protein Vector (Mouse) (pPM-C-HA)
PV203996	ABM	500 ng	EUR 603

NAGK Protein Vector (Mouse) (pPM-C-His)
PV203997	ABM	500 ng	EUR 603

NAGK Protein Vector (Mouse) (pPB-C-His)
PV203998	ABM	500 ng	EUR 603

NAGK Protein Vector (Mouse) (pPB-N-His)
PV203999	ABM	500 ng	EUR 603

NAGK Protein Vector (Mouse) (pPM-C-HA)
PV204000	ABM	500 ng	EUR 603

NAGK Protein Vector (Mouse) (pPM-C-His)
PV204001	ABM	500 ng	EUR 603

Nagk 3'UTR GFP Stable Cell Line
TU163811	ABM	1.0 ml	Ask for price

Nagk 3'UTR Luciferase Stable Cell Line
TU213721	ABM	1.0 ml	Ask for price

NAGK 3'UTR Luciferase Stable Cell Line
TU015187	ABM	1.0 ml	EUR 2333

Nagk 3'UTR Luciferase Stable Cell Line
TU113811	ABM	1.0 ml	Ask for price

NAGK 3'UTR GFP Stable Cell Line
TU065187	ABM	1.0 ml	EUR 2333

Nagk 3'UTR GFP Stable Cell Line
TU263721	ABM	1.0 ml	Ask for price

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody (HRP)
20-abx311736	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody (FITC)
20-abx311737	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

N-Acetyl-D-Glucosamine Kinase (NAGK) Antibody (Biotin)
20-abx311738	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NAGK Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656575	ABM	1.0 ug DNA	EUR 682

NAGK Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656579	ABM	1.0 ug DNA	EUR 682

NAGK Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656580	ABM	1.0 ug DNA	EUR 682