USP25

USP25 Antibody
6143-100
EUR 414
USP25 Antibody
39749-100ul 100ul
EUR 390
USP25 Antibody
1-CSB-PA883400LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
USP25 Antibody
1-CSB-PA025715GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
USP25 siRNA
20-abx939198
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP25 siRNA
20-abx939199
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP25 Polyclonal Antibody
31397-100ul 100ul
EUR 252
USP25 Polyclonal Antibody
31397-50ul 50ul
EUR 187
USP25 Polyclonal Antibody
27724-100ul 100ul
EUR 252
USP25 Polyclonal Antibody
27724-50ul 50ul
EUR 187
USP25 Rabbit pAb
A12588-100ul 100 ul
EUR 308
USP25 Rabbit pAb
A12588-200ul 200 ul
EUR 459
USP25 Rabbit pAb
A12588-20ul 20 ul
EUR 183
USP25 Rabbit pAb
A12588-50ul 50 ul
EUR 223
USP25 Mouse mAb
A1477-100ul 100 ul
EUR 308
USP25 Mouse mAb
A1477-200ul 200 ul
EUR 459
USP25 Mouse mAb
A1477-20ul 20 ul Ask for price
USP25 Mouse mAb
A1477-50ul 50 ul Ask for price
Polyclonal USP25 Antibody
APR00331G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP25 . This antibody is tested and proven to work in the following applications:
Polyclonal USP25 Antibody
APR06877G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP25 . This antibody is tested and proven to work in the following applications:
USP25 cloning plasmid
CSB-CL883400HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1353
  • Sequence: atgaccgtggagcagaacgtgctgcagcagagcgcggcgcagaagcaccagcagacgtttttgaatcaactgagagaaattacggggattaatgacacccagatactacagcaagccttgaaggatagtaatggaaacttggaattagcagtggctttccttactgcgaagaatg
  • Show more
Description: A cloning plasmid for the USP25 gene.
USP25 cloning plasmid
CSB-CL883400HU2-10ug 10ug
EUR 1165
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3168
  • Sequence: atgaccgtggagcagaacgtgctgcagcagagcgcggcgcagaagcaccagcagacgtttttgaatcaactgagagaaattacggggattaatgacacccagatactacagcaagccttgaaggatagtaatggaaacttggaattagcagtggctttccttactgcgaagaatg
  • Show more
Description: A cloning plasmid for the USP25 gene.
USP25 Rabbit pAb
A7975-100ul 100 ul
EUR 308
USP25 Rabbit pAb
A7975-200ul 200 ul
EUR 459
USP25 Rabbit pAb
A7975-20ul 20 ul
EUR 183
USP25 Rabbit pAb
A7975-50ul 50 ul
EUR 223
anti- USP25 antibody
FNab09321 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ubiquitin specific peptidase 25
  • Uniprot ID: Q9UHP3
  • Gene ID: 29761
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP25
Anti-USP25 antibody
PAab09321 100 ug
EUR 386
Anti-USP25 antibody
STJ110282 100 µl
EUR 277
Anti-USP25 antibody
STJ26061 100 µl
EUR 277
Anti-USP25 antibody
STJ114462 100 µl
EUR 277
USP25 Antibody, HRP conjugated
1-CSB-PA883400LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP25 Antibody, FITC conjugated
1-CSB-PA883400LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP25 Antibody, Biotin conjugated
1-CSB-PA883400LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal USP25 Antibody (Internal)
APR03343G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP25 (Internal). This antibody is tested and proven to work in the following applications:
USP25 ELISA KIT|Human
EF004128 96 Tests
EUR 689
Mouse USP25 shRNA Plasmid
20-abx974053
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP25 Polyclonal Conjugated Antibody
C27724 100ul
EUR 397
USP25 Polyclonal Conjugated Antibody
C31397 100ul
EUR 397
Human USP25 shRNA Plasmid
20-abx959218
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP25/28 inhibitor AZ1
HY-117370 5mg
EUR 223
Monoclonal USP25 Antibody, Clone: 1277CT376.106.171
AMM02482G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human USP25. The antibodies are raised in Mouse and are from clone 1277CT376.106.171. This antibody is applicable in WB, E
Usp25 ORF Vector (Mouse) (pORF)
ORF061130 1.0 ug DNA
EUR 506
Usp25 ORF Vector (Rat) (pORF)
ORF078691 1.0 ug DNA
EUR 506
USP25 ORF Vector (Human) (pORF)
ORF011368 1.0 ug DNA
EUR 95
USP25 ORF Vector (Human) (pORF)
ORF011369 1.0 ug DNA
EUR 95
[One Step] USP25 Antibody Kit
RK05720 50 ul
EUR 240
Ubiquitin Specific Peptidase 25 (USP25) Antibody
20-abx116435
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Usp25 sgRNA CRISPR Lentivector set (Rat)
K6322501 3 x 1.0 ug
EUR 339
USP25 sgRNA CRISPR Lentivector set (Human)
K2599401 3 x 1.0 ug
EUR 339
Usp25 sgRNA CRISPR Lentivector set (Mouse)
K3471101 3 x 1.0 ug
EUR 339
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
20-abx007103
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
abx036490-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
20-abx142039
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
abx031555-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
abx031555-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
abx239321-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
20-abx302203
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
20-abx001257
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Usp25 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6322502 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6322503 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6322504 1.0 ug DNA
EUR 154
USP25 sgRNA CRISPR Lentivector (Human) (Target 1)
K2599402 1.0 ug DNA
EUR 154
USP25 sgRNA CRISPR Lentivector (Human) (Target 2)
K2599403 1.0 ug DNA
EUR 154
USP25 sgRNA CRISPR Lentivector (Human) (Target 3)
K2599404 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3471102 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3471103 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3471104 1.0 ug DNA
EUR 154
USP25 Protein Vector (Mouse) (pPB-C-His)
PV244518 500 ng
EUR 1065
USP25 Protein Vector (Mouse) (pPB-N-His)
PV244519 500 ng
EUR 1065
USP25 Protein Vector (Mouse) (pPM-C-HA)
PV244520 500 ng
EUR 1065
USP25 Protein Vector (Mouse) (pPM-C-His)
PV244521 500 ng
EUR 1065
USP25 Protein Vector (Rat) (pPB-C-His)
PV314762 500 ng
EUR 1191
USP25 Protein Vector (Rat) (pPB-N-His)
PV314763 500 ng
EUR 1191
USP25 Protein Vector (Rat) (pPM-C-HA)
PV314764 500 ng
EUR 1191