TUBB1

Human Tubulin Beta 1 (TUBb1) ELISA Kit
DLR-TUBb1-Hu-96T 96T
EUR 673
  • Should the Human Tubulin Beta 1 (TUBb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta 1 (TUBb1) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
DLR-TUBb1-Mu-48T 48T
EUR 527
  • Should the Mouse Tubulin Beta 1 (TUBb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Beta 1 (TUBb1) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
DLR-TUBb1-Mu-96T 96T
EUR 688
  • Should the Mouse Tubulin Beta 1 (TUBb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Beta 1 (TUBb1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Tubulin Beta 1 (TUBb1) ELISA Kit
RDR-TUBb1-Hu-48Tests 48 Tests
EUR 544
Human Tubulin Beta 1 (TUBb1) ELISA Kit
RDR-TUBb1-Hu-96Tests 96 Tests
EUR 756
Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
RDR-TUBb1-Mu-48Tests 48 Tests
EUR 557
Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
RDR-TUBb1-Mu-96Tests 96 Tests
EUR 774
Human Tubulin Beta 1 (TUBb1) ELISA Kit
RD-TUBb1-Hu-48Tests 48 Tests
EUR 521
Human Tubulin Beta 1 (TUBb1) ELISA Kit
RD-TUBb1-Hu-96Tests 96 Tests
EUR 723
Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
RD-TUBb1-Mu-48Tests 48 Tests
EUR 533
Mouse Tubulin Beta 1 (TUBb1) ELISA Kit
RD-TUBb1-Mu-96Tests 96 Tests
EUR 740
TUBB1 antibody
22114-100ul 100ul
EUR 390
TUBB1 antibody
10R-1659 100 ug
EUR 512
Description: Mouse monoclonal TUBB1 antibody
TUBB1 Antibody
1-CSB-PA867148LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
TUBB1 siRNA
20-abx938558
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBB1 siRNA
20-abx938559
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TUBB1
YF-PA21123 50 ug
EUR 363
Description: Mouse polyclonal to TUBB1
anti-TUBB1
YF-PA21124 100 ul
EUR 403
Description: Rabbit polyclonal to TUBB1
anti-TUBB1
YF-PA21125 100 ug
EUR 403
Description: Rabbit polyclonal to TUBB1
TUBB1 Polyclonal Antibody
30175-100ul 100ul
EUR 252
TUBB1 Polyclonal Antibody
30175-50ul 50ul
EUR 187
TUBB1 cloning plasmid
CSB-CL867148HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgcgtgaaattgtccatattcagattggccagtgtggcaaccagatcggagccaagttctgggagatgattggtgaggaacacgggatcgacttggctgggagcgaccgcggggcctcggccttgcagctggagagaatcagcgtgtactacaacgaagcctacggtaggaaat
  • Show more
Description: A cloning plasmid for the TUBB1 gene.
TUBB1 Polyclonal Antibody
A67370 100 µg
EUR 570.55
Description: kits suitable for this type of research
TUBB1 Rabbit pAb
A17779-100ul 100 ul
EUR 308
TUBB1 Rabbit pAb
A17779-200ul 200 ul
EUR 459
TUBB1 Rabbit pAb
A17779-20ul 20 ul
EUR 183
TUBB1 Rabbit pAb
A17779-50ul 50 ul
EUR 223
Anti-TUBB1 antibody
STJ119814 100 µl
EUR 277
Description: This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]
TUBB1 Antibody, HRP conjugated
1-CSB-PA867148LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TUBB1 Antibody, FITC conjugated
1-CSB-PA867148LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TUBB1 Antibody, Biotin conjugated
1-CSB-PA867148LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBB1. Recognizes TUBB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse TUBB1 shRNA Plasmid
20-abx984119
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TUBB1 Polyclonal Conjugated Antibody
C30175 100ul
EUR 397
Human TUBB1 shRNA Plasmid
20-abx962942
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TUBB1 Recombinant Protein (Human)
RP033439 100 ug Ask for price
TUBB1 Recombinant Protein (Mouse)
RP182234 100 ug Ask for price
Monoclonal TUBB1 Antibody, Clone: 2A1A9
AMM08378G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TUBB1. The antibodies are raised in Mouse and are from clone 2A1A9. This antibody is applicable in WB and IHC, FC, ICC, E
Tubulin Beta 1 (TUBB1) Antibody
20-abx005943
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBb1) Antibody
20-abx178748
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
beta I Tubulin (TUBB1) Antibody
20-abx219168
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody
abx224141-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody
20-abx101412
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tubulin Beta 1 (TUBB1) Antibody
20-abx110582
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody
20-abx129118
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
beta 1-Tubulin (TUBB1) Antibody
20-abx134686
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
beta 1-Tubulin (TUBB1) Antibody
20-abx134687
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody
abx145776-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody
20-abx318661
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBB1 Polyclonal Antibody, HRP Conjugated
A67371 100 µg
EUR 570.55
Description: fast delivery possible
TUBB1 Polyclonal Antibody, FITC Conjugated
A67372 100 µg
EUR 570.55
Description: reagents widely cited
TUBB1 Polyclonal Antibody, Biotin Conjugated
A67373 100 µg
EUR 570.55
Description: Ask the seller for details
TUBB1 ORF Vector (Human) (pORF)
ORF011147 1.0 ug DNA
EUR 95
Tubb1 ORF Vector (Mouse) (pORF)
ORF060746 1.0 ug DNA
EUR 506
Recombinant Tubulin Beta 1 (TUBb1)
4-RPE707Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H4B7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tubulin Beta 1 expressed in: E.coli
Recombinant Tubulin Beta 1 (TUBb1)
4-RPE707Mu01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: A2AQ07
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tubulin Beta 1 expressed in: E.coli
TUBB1 ELISA Kit (Human) (OKAN06383)
OKAN06383 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.66 ng/mL
TUBB1 ELISA Kit (Human) (OKCA01570)
OKCA01570 96 Wells
EUR 846
Description: Description of target: Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL
TUBB1 ELISA Kit (Human) (OKCD08693)
OKCD08693 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.55ng/mL
TUBB1 ELISA Kit (Mouse) (OKCD08694)
OKCD08694 96 Wells
EUR 1001
Description: Description of target: Tubulin is the major constituent of microtubules. it binds two moles of gtp, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain (by similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL
TUBb1 ELISA Kit (Mouse) (OKDD00704)
OKDD00704 96 Wells
EUR 988
Description: Description of target: Tubulin is the major constituent of microtubules. it binds two moles of gtp, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.061 ng/mL
Tubulin Beta 1 (TUBB1) Antibody (Biotin)
20-abx106312
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody (FITC)
20-abx107725
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody (HRP)
20-abx109143
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Tubulin Beta 1 (TUBB1) Protein
20-abx166510
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Tubulin Beta 1 (TUBB1) Protein
20-abx069519
  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tubulin Beta 1 (TUBb1) Antibody Pair
20-abx370772
  • EUR 1664.00
  • EUR 1066.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.
Tubulin Beta 1 (TUBB1) Antibody (HRP)
20-abx310961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody (FITC)
20-abx310962
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta 1 (TUBB1) Antibody (Biotin)
20-abx310963
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubb1 sgRNA CRISPR Lentivector set (Mouse)
K3248801 3 x 1.0 ug
EUR 339
TUBB1 sgRNA CRISPR Lentivector set (Human)
K2558401 3 x 1.0 ug
EUR 339
Tubulin Beta 1 Class VI (TUBB1) Antibody
20-abx159741
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta 1 Class VI (TUBB1) Antibody
20-abx159742
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta 1 Class VI (TUBB1) Antibody
abx159743-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.
Tubulin Beta 1 Class VI (TUBB1) Antibody
abx159744-100ul 100 ul
EUR 356
  • Shipped within 5-10 working days.