There will be no Pcr diagnostic detection like before the 90′ due to Filtertip shortage

Due to the elevated use of Pcr, there’s a worldwide shortage of 1000ul and 1250ul PCR filter suggestions for DNA amplification. Big distributors like Gentaur had already constructed up a filter tip inventory to proceed supplying filter suggestions to diagnostic and forensic laboratories however this inventory is already missing the massive filter suggestions. Small filter […]


Can Low-cost Indo Cyanine Green Florescence Technique for Sentinel Lymph Node Biopsy Replace Dual Dye (Radio-colloid and Blue Dye) Technique in Early Breast Cancer: A Prospective Two-arm Comparative Study.

The objective of this study was to assess the detection and accuracy of sentinel lymph node (SLN) biopsy (SLNB) using the low-cost indocyanine green (ICG) fluorescence method and to compare this method with the gold standard dual-dye method (radio-colloid + methylene blue dye [MB]).

One hundred patients with node-negative early breast cancer assessed clinically and by ultrasound axilla underwent an SLNB procedure using technetium-99m radio-colloid, MB, and ICG. The detection rate of SLNs and positive SLNs and the number of SLNs were compared. The injection safety of ICG and MB was evaluated.One hundred female patients with a median age of 52.3 years participated in the study.

Sixty-eight percent had a body mass index < 25, 85% presented with a palpable lump, of which 59% were in the outer quadrant. SLNs were identified in all 100 cases. A total of 290 SLNs were removed (mean, 2.9; range, 1-6). The identification rate with dual dye was 94%, whereas with ICG alone, it was 96%.

The SLNB sensitivity rate and false negative rate were 97.6% versus 93.2% and 3.1% versus 6.2% in the ICG and dual-dye combination, respectively. None of the patients had any local or systemic reaction with ICG; 3 patients with blue dye had tattooing and staining of skin.ICG fluorescence imaging permits real time visualization of lymphatics and provides an additional dimension to SLN biopsy that is safe and effective.

These results confirm high sensitivity for fluorescence localization with comparable performance to the gold standard. ICG can reliably replace dual dye and be employed as a sole tracer for SLNB in early breast cancer.




G108-R 1.0 ml
EUR 71


G108-W 1.0 ml
EUR 71

Absolute Mag Protein A Magnetic Nanoparticles, Dextran Coated, 80 nm

WHM-G108 1 mL
EUR 746

Goat Immunoglobulin G (IgG) ELISA Kit

DLR-IgG-g-48T 48T
EUR 464
  • Should the Goat Immunoglobulin G (IgG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Goat Immunoglobulin G (IgG) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Goat Immunoglobulin G (IgG) ELISA Kit

DLR-IgG-g-96T 96T
EUR 601
  • Should the Goat Immunoglobulin G (IgG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Goat Immunoglobulin G (IgG) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Goat Immunoglobulin G (IgG) ELISA Kit

RDR-IgG-g-48Tests 48 Tests
EUR 482

Goat Immunoglobulin G (IgG) ELISA Kit

RDR-IgG-g-96Tests 96 Tests
EUR 667

Histamine [G-BSA] (G-G-BSA)

DAG3327 1mg
EUR 1234

Hepatitis Surface Antigen subtype Ayw Mutant G-145-R (HBsAg Ayw mutant), Recombinant (P. Pastoris), purified

HBA29-G-145R 50 ug
EUR 347

Cyclin G (Cyclin G) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Cyclin G (Cyclin G) Antibody

abx232129-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Adipokinetic Hormone, G (AKH-G)

5-00610 4 x 5mg Ask for price

Nipah virus Glycoprotein G (G)

  • EUR 1454.00
  • EUR 728.00
  • EUR 984.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 72 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Nipah virus Glycoprotein G(G) expressed in in vitro E.coli expression system

Peptidylprolyl Isomerase G (Cyclophilin G) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139500-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139501-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139502-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139503-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139504-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139505-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139506-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139507-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139508-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139510-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139511-01mg 0.1 mg
EUR 481
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx139512-01mg 0.1 mg
EUR 439
  • Shipped within 5-12 working days.

Leukocyte Antigen G (HLA-G) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034899-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034900-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034900-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034168-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx034168-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Endonuclease G, Mitochondrial (Endo G) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Major Surface Glycoprotein G (G) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leukocyte Antigen G (HLA-G) Antibody

abx413633-02mg 0.2 mg
EUR 648
  • Shipped within 1 week.

Leukocyte Antigen G (HLA-G) Antibody

abx413634-02mg 0.2 mg
EUR 648
  • Shipped within 1 week.

Protein Kinase G Substrate; G-Subtide

  • EUR 439.00
  • EUR 718.00
  • EUR 328.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

Adipokinetic Hormone, G (AKH-G) Peptide

  • EUR 509.00
  • EUR 857.00
  • EUR 370.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.


5-01166 4 x 5mg Ask for price


5-01167 4 x 5mg Ask for price


5-01169 4 x 5mg Ask for price

Protein Kinase G Substrate; G-Subtide

5-01842 4 x 5mg Ask for price


5-01863 4 x 5mg Ask for price

Protein G

abx670070-5mg 5 mg
EUR 759
  • Shipped within 1 week.

Protein G

abx670076-1mg 1 mg
EUR 495
  • Shipped within 1 week.

Thiamet G

B2048-25 25 mg
EUR 350
Description: Thiamet G is a potent and selective inhibitor of O-GlcNAcase with Ki value of 21 nM [1].O-GlcNAcase is an enzyme that removes GlcNAc from proteins.

Thiamet G

B2048-5 5 mg
EUR 128
Description: Thiamet G is a potent and selective inhibitor of O-GlcNAcase with Ki value of 21 nM [1].O-GlcNAcase is an enzyme that removes GlcNAc from proteins.

Thiamet G

B2048-5.1 10 mM (in 1mL DMSO)
EUR 131
Description: Thiamet G is a potent and selective inhibitor of O-GlcNAcase with Ki value of 21 nM [1].O-GlcNAcase is an enzyme that removes GlcNAc from proteins.


EUR 131


EUR 349


B5707-10 10 mg
EUR 273

Antagonist G

B5243-1 1 mg
EUR 340


B5455-10 10 mg
EUR 273
Description: G-1 is a potent and selective agonist of GPR30 with EC50 value of 2 nM [1].G protein-coupled receptor 30 (GPR30) is an integral membrane protein that localizes to the endoplasmic reticulum and with high affinity for estradiol and aldosterone.


B5469-10 10 mg
EUR 273
Description: G-15 is a selective antagonist of GPR30 with Ki value of 20 nM [1].G protein-coupled receptor 30 (GPR30) is an integral membrane protein that localizes to the endoplasmic reticulum and with high affinity for estradiol and aldosterone.

Conantokin G

B5533-.5 500 ug
EUR 399


E21-002 10ug
EUR 343


HY-107216 10mg
EUR 360


HY-19635 50mg
EUR 785


HY-12333 25mg
EUR 481

Thiamet G

HY-12588 50mg
EUR 601

Neuropeptide g

H-7455.0500 0.5mg
EUR 181
Description: Sum Formula: C99H158N34O29S; CAS# [114882-65-4] net

Neuropeptide g

H-7455.1000 1.0mg
EUR 300
Description: Sum Formula: C99H158N34O29S; CAS# [114882-65-4] net


H-2725.0001 1.0mg
EUR 151
Description: Sum Formula: C83H131N19O27S; CAS# [60893-02-9]


H-2725.0005 5.0mg
EUR 515
Description: Sum Formula: C83H131N19O27S; CAS# [60893-02-9]

Alisol G

HY-N0855 10mg
EUR 739

Gomisin G

HY-N0858 10mg
EUR 739

Tenacissoside G

HY-N2103 1mg
EUR 179

Hosenkoside G

HY-N2242 1mg
EUR 313

Rebaudioside G

HY-N2291 1mg
EUR 379

Saikosaponin G

HY-N4216 1mg
EUR 443

Kuwanon G

HY-N4247 10mg
EUR 436

Sulforhodamine g

80102 5G
EUR 165
Description: Minimum order quantity: 1 unit of 5G


A8889-1 1 mg
EUR 108
Description: G-749 is a selective inhibitor of Fms-like tyrosine receptor kinase-3 (FLT3) with IC50 value of 0.4 nM for wild-type FLT31.G-749 is a synthesized and ATP-competitive inhibitor of wild-type FLT3 with high potency.


A8889-5 5 mg
EUR 212
Description: G-749 is a selective inhibitor of Fms-like tyrosine receptor kinase-3 (FLT3) with IC50 value of 0.4 nM for wild-type FLT31.G-749 is a synthesized and ATP-competitive inhibitor of wild-type FLT3 with high potency.


A8889-5.1 10 mM (in 1mL DMSO)
EUR 422
Description: G-749 is a selective inhibitor of Fms-like tyrosine receptor kinase-3 (FLT3) with IC50 value of 0.4 nM for wild-type FLT31.G-749 is a synthesized and ATP-competitive inhibitor of wild-type FLT3 with high potency.

Antagonist G

5-00704 0.4 x 5mg Ask for price

Conantokin G

5-00989 4 x 1mg Ask for price


5-01165 4 x 5mg Ask for price


5-02089 4 x 5mg Ask for price

Protein G

30C-CX4512 10 mg
EUR 456
Description: Immunoglobulin-binding bacterial Protein G solution

Protein G

EUR 147

Protein G

EUR 468

Protein G

EUR 2328

Protein G

EUR 10321

Protein G

EUR 283

Protein G

6510-5000 Ask for price

G Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against G. Recognizes G from Human. This antibody is Unconjugated. Tested in the following application: ELISA

G Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against G. Recognizes G from Human respiRatory syncytial virus A. This antibody is Unconjugated. Tested in the following application: ELISA

G Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against G. Recognizes G from Rabies virus. This antibody is Unconjugated. Tested in the following application: ELISA

G Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against G. Recognizes G from Rabies virus. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Tenacissoside G

N2128-20 20 mg
EUR 282
Description: Extracted from Marsdenia tenacissima (Roxb.) Wight et Arn.;Store the product in sealed, cool and dry condition

Cathepsin G

MO20021 100 ul
EUR 213


PVT11136 2 ug
EUR 266


PVT14629 2 ug
EUR 703

Alisol G

TA004029 10mg
EUR 570

Sophoraflavanone G

TB02920 10mg
EUR 228

Tenacissoside G

TB0420-0020 25mg
EUR 355

Gomisin G

TB0551-0020 10mg
EUR 355

Hosenkoside G

TB0882-0025 10mg
EUR 484

Negsehisandrin G

TB0907-0100 0.05ml
EUR 526

Rebaudioside G

TBW00142 10mg
EUR 484

Monnieriside G

TBW00193 5mg
EUR 634

Saikosaponin G

TBW00466 10mg
EUR 735

Erythrinin G

TBW00592 unit Ask for price

Leachianone G

TBW00594 unit Ask for price

Millewanin G

TBW00595 unit Ask for price

Buergerinin G

TBW00708 unit Ask for price

Mulberrofuran G

TBW00940 5mg Ask for price

Kalopanaxsaponin G

TBW01091 10mg Ask for price

Prosaikogenin G

TBW01602 unit Ask for price

Sarothralen G

TBZ0831 unit Ask for price

Yadanzioside G

TBZ1052 unit Ask for price

Budmunchiamine G

TBZ1131 unit Ask for price

Heteroclitin G

TBZ1388 unit Ask for price

Ixerin G

TBZ1500 unit Ask for price

Oleiferin G

TBZ1737 unit Ask for price

Senkyunolide G

TBZ1897 20mg Ask for price

Swietemahonin G

TBZ1935 unit Ask for price

Agrimol G

TBZ30073 unit Ask for price

Angulaturoid G

TBZ30107 unit Ask for price

C-Dots and composites based on them face the challenges of poor stability, especially under photo-radiation, and low solid-state photoluminescence quantum yields (PLQYs), which hinder their application in optical devices.

Herein, a novel 2-dimensional hybrid material of polysiloxane embedded with Si-doped carbon dots (P-E-Si-CDs) was synthesized by a self-assembly approach, and the hybrid composite exhibited broadband blue-green fluorescence emission, outstanding photostability, high thermal stability, and a high PLQY of 82.8%.

Moreover, the dual fluorescent emissions were demonstrated the creation of two closed-loop fluorophores.

Using the as-prepared hybrid fluorescent material, fabricated light-emitting diodes (LEDs) based on UV and blue-emitting LED chips present safe warm white light emission and adjustable white emission with a high color rendering index of up to 91, respectively.

This work provides a novel strategy for the design and realization of Si-CD-based hybrid composites, thus promising their prospective use commercially in LED lighting.


USP25 Antibody
EUR 414
USP25 Antibody
39749-100ul 100ul
EUR 390
USP25 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
USP25 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP25 Polyclonal Antibody
31397-100ul 100ul
EUR 252
USP25 Polyclonal Antibody
31397-50ul 50ul
EUR 187
USP25 Polyclonal Antibody
27724-100ul 100ul
EUR 252
USP25 Polyclonal Antibody
27724-50ul 50ul
EUR 187
USP25 Rabbit pAb
A12588-100ul 100 ul
EUR 308
USP25 Rabbit pAb
A12588-200ul 200 ul
EUR 459
USP25 Rabbit pAb
A12588-20ul 20 ul
EUR 183
USP25 Rabbit pAb
A12588-50ul 50 ul
EUR 223
USP25 Mouse mAb
A1477-100ul 100 ul
EUR 308
USP25 Mouse mAb
A1477-200ul 200 ul
EUR 459
USP25 Mouse mAb
A1477-20ul 20 ul Ask for price
USP25 Mouse mAb
A1477-50ul 50 ul Ask for price
Polyclonal USP25 Antibody
APR00331G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP25 . This antibody is tested and proven to work in the following applications:
Polyclonal USP25 Antibody
APR06877G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP25 . This antibody is tested and proven to work in the following applications:
USP25 cloning plasmid
CSB-CL883400HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1353
  • Sequence: atgaccgtggagcagaacgtgctgcagcagagcgcggcgcagaagcaccagcagacgtttttgaatcaactgagagaaattacggggattaatgacacccagatactacagcaagccttgaaggatagtaatggaaacttggaattagcagtggctttccttactgcgaagaatg
  • Show more
Description: A cloning plasmid for the USP25 gene.
USP25 cloning plasmid
CSB-CL883400HU2-10ug 10ug
EUR 1165
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3168
  • Sequence: atgaccgtggagcagaacgtgctgcagcagagcgcggcgcagaagcaccagcagacgtttttgaatcaactgagagaaattacggggattaatgacacccagatactacagcaagccttgaaggatagtaatggaaacttggaattagcagtggctttccttactgcgaagaatg
  • Show more
Description: A cloning plasmid for the USP25 gene.
USP25 Rabbit pAb
A7975-100ul 100 ul
EUR 308
USP25 Rabbit pAb
A7975-200ul 200 ul
EUR 459
USP25 Rabbit pAb
A7975-20ul 20 ul
EUR 183
USP25 Rabbit pAb
A7975-50ul 50 ul
EUR 223
anti- USP25 antibody
FNab09321 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ubiquitin specific peptidase 25
  • Uniprot ID: Q9UHP3
  • Gene ID: 29761
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP25
Anti-USP25 antibody
PAab09321 100 ug
EUR 386
Anti-USP25 antibody
STJ110282 100 µl
EUR 277
Anti-USP25 antibody
STJ26061 100 µl
EUR 277
Anti-USP25 antibody
STJ114462 100 µl
EUR 277
USP25 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP25 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP25 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP25. Recognizes USP25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal USP25 Antibody (Internal)
APR03343G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP25 (Internal). This antibody is tested and proven to work in the following applications:
EF004128 96 Tests
EUR 689
Mouse USP25 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP25 Polyclonal Conjugated Antibody
C27724 100ul
EUR 397
USP25 Polyclonal Conjugated Antibody
C31397 100ul
EUR 397
Human USP25 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP25/28 inhibitor AZ1
HY-117370 5mg
EUR 223
Monoclonal USP25 Antibody, Clone: 1277CT376.106.171
AMM02482G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human USP25. The antibodies are raised in Mouse and are from clone 1277CT376.106.171. This antibody is applicable in WB, E
Usp25 ORF Vector (Mouse) (pORF)
ORF061130 1.0 ug DNA
EUR 506
Usp25 ORF Vector (Rat) (pORF)
ORF078691 1.0 ug DNA
EUR 506
USP25 ORF Vector (Human) (pORF)
ORF011368 1.0 ug DNA
EUR 95
USP25 ORF Vector (Human) (pORF)
ORF011369 1.0 ug DNA
EUR 95
[One Step] USP25 Antibody Kit
RK05720 50 ul
EUR 240
Ubiquitin Specific Peptidase 25 (USP25) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Usp25 sgRNA CRISPR Lentivector set (Rat)
K6322501 3 x 1.0 ug
EUR 339
USP25 sgRNA CRISPR Lentivector set (Human)
K2599401 3 x 1.0 ug
EUR 339
Usp25 sgRNA CRISPR Lentivector set (Mouse)
K3471101 3 x 1.0 ug
EUR 339
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
abx036490-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
abx031555-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
abx031555-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
abx239321-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 25 (USP25) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Usp25 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6322502 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6322503 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6322504 1.0 ug DNA
EUR 154
USP25 sgRNA CRISPR Lentivector (Human) (Target 1)
K2599402 1.0 ug DNA
EUR 154
USP25 sgRNA CRISPR Lentivector (Human) (Target 2)
K2599403 1.0 ug DNA
EUR 154
USP25 sgRNA CRISPR Lentivector (Human) (Target 3)
K2599404 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3471102 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3471103 1.0 ug DNA
EUR 154
Usp25 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3471104 1.0 ug DNA
EUR 154
USP25 Protein Vector (Mouse) (pPB-C-His)
PV244518 500 ng
EUR 1065
USP25 Protein Vector (Mouse) (pPB-N-His)
PV244519 500 ng
EUR 1065
USP25 Protein Vector (Mouse) (pPM-C-HA)
PV244520 500 ng
EUR 1065
USP25 Protein Vector (Mouse) (pPM-C-His)
PV244521 500 ng
EUR 1065
USP25 Protein Vector (Rat) (pPB-C-His)
PV314762 500 ng
EUR 1191
USP25 Protein Vector (Rat) (pPB-N-His)
PV314763 500 ng
EUR 1191
USP25 Protein Vector (Rat) (pPM-C-HA)
PV314764 500 ng
EUR 1191


WIPI1 antibody
70R-4358 50 ug
EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the N terminal of WIPI1
WIPI1 antibody
70R-4359 50 ug
EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the middle region of WIPI1
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WIPI1 Polyclonal Antibody
30955-100ul 100ul
EUR 252
WIPI1 Polyclonal Antibody
30955-50ul 50ul
EUR 187
WIPI1 Blocking Peptide
33R-5144 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WIPI1 antibody, catalog no. 70R-4359
WIPI1 Blocking Peptide
33R-1237 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TTMB antibody, catalog no. 70R-6812
Polyclonal WIPI1 Antibody
APR10748G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 . This antibody is tested and proven to work in the following applications:
WIPI1 cloning plasmid
CSB-CL705810HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1341
  • Sequence: atggaggccgaggccgcggacgctcccccgggcggggttgagtcggcgctcagctgcttctctttcaaccaggactgcacatccctagcaattggaactaaagccgggtataagctgttttctctgagttctgtggagcagctggatcaagtccacggaagcaatgaaatcccgg
  • Show more
Description: A cloning plasmid for the WIPI1 gene.
WIPI1 Rabbit pAb
A7528-100ul 100 ul
EUR 308
WIPI1 Rabbit pAb
A7528-200ul 200 ul
EUR 459
WIPI1 Rabbit pAb
A7528-20ul 20 ul
EUR 183
WIPI1 Rabbit pAb
A7528-50ul 50 ul
EUR 223
WIPI1 Polyclonal Antibody
ABP57486-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1
WIPI1 Polyclonal Antibody
ABP57486-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1
WIPI1 Polyclonal Antibody
ABP57486-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1
WIPI1 Polyclonal Antibody
ES8479-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
WIPI1 Polyclonal Antibody
ES8479-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI1 from Human/mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
anti- WIPI1 antibody
FNab09512 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: WD repeat domain, phosphoinositide interacting 1
  • Uniprot ID: Q5MNZ9
  • Gene ID: 55062
  • Research Area: Metabolism
Description: Antibody raised against WIPI1
Anti-WIPI1 antibody
PAab09512 100 ug
EUR 412
Anti-WIPI1 antibody
STJ29666 100 µl
EUR 277
Description: This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants.
Anti-WIPI1 antibody
STJ98592 200 µl
EUR 197
Description: Rabbit polyclonal to WIPI1.
Anti-WIPI1 (3C1)
YF-MA18725 100 ug
EUR 363
Description: Mouse monoclonal to WIPI1
Polyclonal WIPI1 Antibody (Center)
APR10749G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (Center). This antibody is tested and proven to work in the following applications:
Mouse Wipi1 ELISA KIT
ELI-17524m 96 Tests
EUR 865
ELI-17850h 96 Tests
EUR 824
EF004296 96 Tests
EUR 689
Mouse WIPI1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WIPI1 Polyclonal Conjugated Antibody
C30955 100ul
EUR 397
Human WIPI1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WIPI1 Recombinant Protein (Rat)
RP237437 100 ug Ask for price
PVT16839 2 ug
EUR 325
WIPI1 Recombinant Protein (Human)
RP034801 100 ug Ask for price
WIPI1 Recombinant Protein (Mouse)
RP185606 100 ug Ask for price
Polyclonal WIPI1 Antibody (N-term)
APR10751G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (N-term). This antibody is tested and proven to work in the following applications:
Wipi1 ORF Vector (Mouse) (pORF)
ORF061870 1.0 ug DNA
EUR 506
Wipi1 ORF Vector (Rat) (pORF)
ORF079147 1.0 ug DNA
EUR 506
WIPI1 ORF Vector (Human) (pORF)
ORF011601 1.0 ug DNA
EUR 95
Polyclonal ATG18 / WIPI1 Antibody (C-Terminus)
APG02035G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG18 / WIPI1 (C-Terminus). This antibody is tested and proven to work in the following applications:
Wipi1 sgRNA CRISPR Lentivector set (Rat)
K6158301 3 x 1.0 ug
EUR 339
WIPI1 sgRNA CRISPR Lentivector set (Human)
K2640401 3 x 1.0 ug
EUR 339
Wipi1 sgRNA CRISPR Lentivector set (Mouse)
K3959601 3 x 1.0 ug
EUR 339
Monoclonal WIPI1 Antibody (monoclonal) (M02), Clone: 3C1
APR10750G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human WIPI1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3C1. This antibody is applicable in WB, E
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6158302 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6158303 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6158304 1.0 ug DNA
EUR 154
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2640402 1.0 ug DNA
EUR 154
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2640403 1.0 ug DNA
EUR 154
WIPI1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2640404 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3959602 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3959603 1.0 ug DNA
EUR 154
Wipi1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3959604 1.0 ug DNA
EUR 154
WIPI1 Protein Vector (Mouse) (pPB-C-His)
PV247478 500 ng
EUR 603
WIPI1 Protein Vector (Mouse) (pPB-N-His)
PV247479 500 ng
EUR 603
WIPI1 Protein Vector (Mouse) (pPM-C-HA)
PV247480 500 ng
EUR 603
WIPI1 Protein Vector (Mouse) (pPM-C-His)
PV247481 500 ng
EUR 603
WIPI1 Protein Vector (Rat) (pPB-C-His)
PV316586 500 ng
EUR 603
WIPI1 Protein Vector (Rat) (pPB-N-His)
PV316587 500 ng
EUR 603
WIPI1 Protein Vector (Rat) (pPM-C-HA)
PV316588 500 ng
EUR 603
WIPI1 Protein Vector (Rat) (pPM-C-His)
PV316589 500 ng
EUR 603
WIPI1 Protein Vector (Human) (pPB-C-His)
PV046401 500 ng
EUR 329
WIPI1 Protein Vector (Human) (pPB-N-His)
PV046402 500 ng
EUR 329
WIPI1 Protein Vector (Human) (pPM-C-HA)
PV046403 500 ng
EUR 329
WIPI1 Protein Vector (Human) (pPM-C-His)
PV046404 500 ng
EUR 329
Wipi1 3'UTR Luciferase Stable Cell Line
TU122310 1.0 ml Ask for price
WIPI1 3'UTR GFP Stable Cell Line
TU078498 1.0 ml
EUR 1394
Wipi1 3'UTR GFP Stable Cell Line
TU172310 1.0 ml Ask for price
Wipi1 3'UTR Luciferase Stable Cell Line
TU223410 1.0 ml Ask for price
WIPI1 3'UTR Luciferase Stable Cell Line
TU028498 1.0 ml
EUR 1394
Wipi1 3'UTR GFP Stable Cell Line
TU273410 1.0 ml Ask for price
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
abx031393-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
WD Repeat Domain Phosphoinositide-Interacting Protein 1 (WIPI1) Antibody
abx031393-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.



  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EEF1A1 Antibody

ABD6156 100 ug
EUR 438

eEF1A1 Antibody

49856-100ul 100ul
EUR 333

eEF1A1 Antibody

49856-50ul 50ul
EUR 239

EEF1A1 Antibody

32103-100ul 100ul
EUR 252

EEF1A1 antibody

70R-17000 50 ul
EUR 435
Description: Rabbit polyclonal EEF1A1 antibody

EEF1A1 antibody

70R-1029 100 ug
EUR 377
Description: Rabbit polyclonal EEF1A1 antibody raised against the C terminal of EEF1A1

EEF1A1 Antibody

DF6156 200ul
EUR 304
Description: EEF1A1 Antibody detects endogenous levels of total EEF1A1.

EEF1A1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

EEF1A1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


YF-PA23621 50 ul
EUR 334
Description: Mouse polyclonal to eEF1A1

eEF1A1 Conjugated Antibody

C49856 100ul
EUR 397

EEF1A1 Conjugated Antibody

C32103 100ul
EUR 397

EEF1A1 cloning plasmid

CSB-CL007409HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1389
  • Sequence: atgggaaaggaaaagactcatatcaacattgtcgtcattggacacgtagattcgggcaagtccaccactactggccatctgatctataaatgcggtggcatcgacaaaagaaccattgaaaaatttgagaaggaggctgctgagatgggaaagggctccttcaagtatgcctggg
  • Show more
Description: A cloning plasmid for the EEF1A1 gene.

anti- EEF1A1 antibody

FNab02641 100µg
EUR 548.75
  • Immunogen: eukaryotic translation elongation factor 1 alpha 1
  • Uniprot ID: P68104
  • Gene ID: 1915
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EEF1A1

eEF1A1 Rabbit mAb

A11545-100ul 100 ul
EUR 410

eEF1A1 Rabbit mAb

A11545-200ul 200 ul
EUR 571

eEF1A1 Rabbit mAb

A11545-20ul 20 ul
EUR 221

eEF1A1 Rabbit mAb

A11545-50ul 50 ul
EUR 287

EEF1A1 Rabbit pAb

A0831-100ul 100 ul
EUR 308

EEF1A1 Rabbit pAb

A0831-200ul 200 ul
EUR 459

EEF1A1 Rabbit pAb

A0831-20ul 20 ul Ask for price

EEF1A1 Rabbit pAb

A0831-50ul 50 ul Ask for price

EEF1A1 Rabbit pAb

A0974-100ul 100 ul
EUR 308

EEF1A1 Rabbit pAb

A0974-200ul 200 ul
EUR 459

EEF1A1 Rabbit pAb

A0974-20ul 20 ul
EUR 183

EEF1A1 Rabbit pAb

A0974-50ul 50 ul
EUR 223

EEF1A1 Rabbit pAb

A17857-100ul 100 ul
EUR 308

EEF1A1 Rabbit pAb

A17857-200ul 200 ul
EUR 459

EEF1A1 Rabbit pAb

A17857-20ul 20 ul
EUR 183

EEF1A1 Rabbit pAb

A17857-50ul 50 ul
EUR 223

EEF1A1 Blocking Peptide

33R-4196 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1A1 antibody, catalog no. 70R-1029

Human EEF1A1 Antibody

35679-05111 150 ug
EUR 261

EEF1A1 Blocking Peptide

DF6156-BP 1mg
EUR 195

Anti-EEF1A1 antibody

PAab02641 100 ug
EUR 386


PVT13636 2 ug
EUR 391

Anti-EEF1A1 antibody

STJ111034 100 µl
EUR 277
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Anti-EEF1A1 antibody

STJ23475 100 µl
EUR 277
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Anti-EEF1A1 antibody

STJ119870 100 µl
EUR 277
Description: This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes.

Rat EEF1A1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EEF1A1 ELISA Kit

ELA-E11476h 96 Tests
EUR 824


EF003718 96 Tests
EUR 689

EEF1A1 / EEF1A2 / EEF1A1P5 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human EEF1A1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EEF1A1 protein (His tag)

80R-3746 100 ug
EUR 349
Description: Purified recombinant EEF1A1 protein (His tag)

eEF1A1 recombinant monoclonal antibody

A5854 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human eEF1A1 for WB, IHC,ELISA

Mouse EEF1A1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Acetyl-EEF1A1 (K41) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-EEF1A1 (K41). Recognizes Acetyl-EEF1A1 (K41) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1A1/EEF1A2/EEF1A1P5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF1A1/EEF1A2/EEF1A1P5. Recognizes EEF1A1/EEF1A2/EEF1A1P5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1A1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF1A1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF1A1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1A1. Recognizes EEF1A1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EEF1A1 Recombinant Protein (Human)

RP010192 100 ug Ask for price

EEF1A1 Recombinant Protein (Rat)

RP199079 100 ug Ask for price

EEF1A1 Recombinant Protein (Mouse)

RP130895 100 ug Ask for price

Polyclonal EEF1A1 Antibody (N-term)

APR05771G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal EEF1A1 Antibody (C-term)

APR05772G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1A1 (C-term). This antibody is tested and proven to work in the following applications:

Human EEF1A1 Antibody (Biotin Conjugate)

35679-05121 150 ug
EUR 369

EEF1A1 ORF Vector (Human) (pORF)

ORF003398 1.0 ug DNA
EUR 95

Eef1a1 ORF Vector (Rat) (pORF)

ORF066361 1.0 ug DNA
EUR 506

Eef1a1 ORF Vector (Mouse) (pORF)

ORF043633 1.0 ug DNA
EUR 506

EEF1A1 ELISA Kit (Human) (OKCD08740)

OKCD08740 96 Wells
EUR 975
Description: Description of target: EEF1A1 is an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome.This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

EEF1A1 ELISA Kit (Mouse) (OKEH05651)

OKEH05651 96 Wells
EUR 779
Description: Description of target: This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis. With PARP1 and TXK, forms a complex that acts as a T helper 1 (Th1) cell-specific transcription factor and binds the promoter of IFN-gamma to directly regulate its transcription, and is thus involved importantly in Th1 cytokine production.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

EEF1A1 ELISA Kit (Bovine) (OKEH07735)

OKEH07735 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

EEF1A1 sgRNA CRISPR Lentivector set (Human)

K0654801 3 x 1.0 ug
EUR 339

Human EEF1A1 AssayLite Antibody (FITC Conjugate)

35679-05141 150 ug
EUR 428

Human EEF1A1 AssayLite Antibody (RPE Conjugate)

35679-05151 150 ug
EUR 428

Human EEF1A1 AssayLite Antibody (APC Conjugate)

35679-05161 150 ug
EUR 428


RAB36 Antibody

46185-50ul 50ul
EUR 187

RAB36 Antibody

DF9827 200ul
EUR 304
Description: RAB36 Antibody detects endogenous levels of total RAB36.

RAB36 antibody

70R-51354 100 ul
EUR 244
Description: Purified Polyclonal RAB36 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB36 Antibody

ABD9827 100 ug
EUR 438


YF-PA25378 50 ul
EUR 334
Description: Mouse polyclonal to RAB36

RAB36 Blocking Peptide

DF9827-BP 1mg
EUR 195

RAB36 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB36 Conjugated Antibody

C46185 100ul
EUR 397

RAB36 Polyclonal Antibody

ABP60067-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAB36 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of RAB36 from Human, Mouse. This RAB36 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB36 protein at amino acid sequence of 170-250

RAB36 Polyclonal Antibody

ABP60067-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB36 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of RAB36 from Human, Mouse. This RAB36 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB36 protein at amino acid sequence of 170-250

RAB36 Polyclonal Antibody

ABP60067-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB36 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of RAB36 from Human, Mouse. This RAB36 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB36 protein at amino acid sequence of 170-250

RAB36 Polyclonal Antibody

ES10124-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB36 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB36 Polyclonal Antibody

ES10124-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB36 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti-RAB36 (6A6)

LF-MA10268 50 ug
EUR 363
Description: Mouse monoclonal to RAB36

Anti-RAB36 antibody

STJ191282 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB36

Anti-RAB36 (6A6)

YF-MA20479 200 ul
EUR 363
Description: Mouse monoclonal to RAB36