RPL34 antibody
70R-33954	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL34 antibody

RPL34 Antibody
ABD3708	Lifescience Market	100 ug	EUR 438

RPL34 Antibody
34356-100ul	SAB	100ul	EUR 252

RPL34 Antibody
34356-50ul	SAB	50ul	EUR 187

RPL34 siRNA
20-abx931960	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL34 siRNA
20-abx931961	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL34 Antibody
DF3708	Affbiotech	200ul	EUR 304
Description: RPL34 Antibody detects endogenous levels of total RPL34.

RPL34 Antibody
1-CSB-PA003987	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

RPL34 Antibody
CSB-PA299301-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

RPL34 Antibody
CSB-PA299301-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

RPL34 Antibody
1-CSB-PA020243LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-RPL34
YF-PA24611	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPL34

RPL34 Conjugated Antibody
C34356	SAB	100ul	EUR 397

RPL34 cloning plasmid
CSB-CL020243HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 354 Sequence: atggtccagcgtttgacataccgacgtaggctttcctacaatacagcctctaacaaaactaggctgtcccgaacccctggtaatagaattgtttacctttataccaagaaggttgggaaagcaccaaaatctgcatgtggtgtgtgcccaggcagacttcgaggggttcgtgctgt Show more
Description: A cloning plasmid for the RPL34 gene.

RPL34 Antibody (HRP)
20-abx305170	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RPL34 Antibody (FITC)
20-abx305171	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RPL34 Antibody (Biotin)
20-abx305172	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RPL34 Polyclonal Antibody
A63350	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RPL34 Rabbit pAb
A15716-100ul	Abclonal	100 ul	EUR 308

RPL34 Rabbit pAb
A15716-200ul	Abclonal	200 ul	EUR 459

RPL34 Rabbit pAb
A15716-20ul	Abclonal	20 ul	EUR 183

RPL34 Rabbit pAb
A15716-50ul	Abclonal	50 ul	EUR 223

Human RPL34 Antibody
32819-05111	AssayPro	150 ug	EUR 261

RPL34 Blocking Peptide
DF3708-BP	Affbiotech	1mg	EUR 195

Anti-RPL34 antibody
STJ118176	St John's Laboratory	100 µl	EUR 277

Mouse RPL34 shRNA Plasmid
20-abx976612	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RPL34 shRNA Plasmid
20-abx954147	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL34 protein (His tag)
80R-3042	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant RPL34 protein (His tag)

RPL34 Antibody, HRP conjugated
1-CSB-PA020243LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL34 Antibody, FITC conjugated
1-CSB-PA020243LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL34 Antibody, Biotin conjugated
1-CSB-PA020243LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL34 Recombinant Protein (Human)
RP026974	ABM	100 ug	Ask for price

RPL34 Recombinant Protein (Rat)
RP226673	ABM	100 ug	Ask for price

RPL34 Recombinant Protein (Mouse)
RP169046	ABM	100 ug	Ask for price

RPL34 Recombinant Protein (Mouse)
RP169049	ABM	100 ug	Ask for price

Ribosomal Protein L34 (RPL34) Antibody
20-abx329438	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L34 (RPL34) Antibody
abx218301-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Ribosomal Protein L34 (RPL34) Antibody
abx332300-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Ribosomal Protein L34 (RPL34) Antibody
20-abx305169	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RPL34 Polyclonal Antibody, HRP Conjugated
A63351	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RPL34 Polyclonal Antibody, FITC Conjugated
A63352	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RPL34 Polyclonal Antibody, Biotin Conjugated
A63353	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Human RPL34 Antibody (Biotin Conjugate)
32819-05121	AssayPro	150 ug	EUR 369

RPL34 ORF Vector (Human) (pORF)
ORF008992	ABM	1.0 ug DNA	EUR 95

Rpl34 ORF Vector (Mouse) (pORF)
ORF056350	ABM	1.0 ug DNA	EUR 506

Rpl34 ORF Vector (Mouse) (pORF)
ORF056351	ABM	1.0 ug DNA	EUR 506

Rpl34 ORF Vector (Rat) (pORF)
ORF075559	ABM	1.0 ug DNA	EUR 506

Rpl34-ps1 Recombinant Protein (Mouse)
RP169052	ABM	100 ug	Ask for price

Anti-RPL34/Ribosomal Protein L34 Antibody
A08190	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RPL34/Ribosomal Protein L34 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Human RPL34 AssayLite Antibody (FITC Conjugate)
32819-05141	AssayPro	150 ug	EUR 428

Human RPL34 AssayLite Antibody (RPE Conjugate)
32819-05151	AssayPro	150 ug	EUR 428

Human RPL34 AssayLite Antibody (APC Conjugate)
32819-05161	AssayPro	150 ug	EUR 428

Human RPL34 AssayLite Antibody (PerCP Conjugate)
32819-05171	AssayPro	150 ug	EUR 471

RPL34 sgRNA CRISPR Lentivector set (Human)
K1970201	ABM	3 x 1.0 ug	EUR 339

Rpl34 sgRNA CRISPR Lentivector set (Mouse)
K4494401	ABM	3 x 1.0 ug	EUR 339

Rpl34 sgRNA CRISPR Lentivector set (Rat)
K6238301	ABM	3 x 1.0 ug	EUR 339

Rpl34-ps1 ORF Vector (Mouse) (pORF)
ORF056352	ABM	1.0 ug DNA	EUR 506

RPL34 sgRNA CRISPR Lentivector (Human) (Target 1)
K1970202	ABM	1.0 ug DNA	EUR 154

RPL34 sgRNA CRISPR Lentivector (Human) (Target 2)
K1970203	ABM	1.0 ug DNA	EUR 154

RPL34 sgRNA CRISPR Lentivector (Human) (Target 3)
K1970204	ABM	1.0 ug DNA	EUR 154

Rpl34 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4494402	ABM	1.0 ug DNA	EUR 154

Rpl34 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4494403	ABM	1.0 ug DNA	EUR 154

Rpl34 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4494404	ABM	1.0 ug DNA	EUR 154

Rpl34-ps1 sgRNA CRISPR Lentivector set (Mouse)
K4317101	ABM	3 x 1.0 ug	EUR 339

Rpl34 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6238302	ABM	1.0 ug DNA	EUR 154

Rpl34 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6238303	ABM	1.0 ug DNA	EUR 154

Rpl34 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6238304	ABM	1.0 ug DNA	EUR 154

RPL34 Protein Vector (Human) (pPB-C-His)
PV035965	ABM	500 ng	EUR 329

RPL34 Protein Vector (Human) (pPB-N-His)
PV035966	ABM	500 ng	EUR 329

RPL34 Protein Vector (Human) (pPM-C-HA)
PV035967	ABM	500 ng	EUR 329

RPL34 Protein Vector (Human) (pPM-C-His)
PV035968	ABM	500 ng	EUR 329

Recombinant Human RPL34 Protein, His, E.coli-1mg
QP13347-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human RPL34 Protein, His, E.coli-20ug
QP13347-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human RPL34 Protein, His, E.coli-5ug
QP13347-5ug	EnQuireBio	5ug	EUR 155

RPL34 Ribosomal Protein L34 Human Recombinant Protein
PROTP49207	BosterBio	Regular: 20ug	EUR 317
Description: RPL34 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 140 amino acids (1-117) and having a molecular mass of 15.7kDa.;RPL34 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL34 Protein Vector (Rat) (pPB-C-His)
PV302234	ABM	500 ng	EUR 603

RPL34 Protein Vector (Rat) (pPB-N-His)
PV302235	ABM	500 ng	EUR 603

RPL34 Protein Vector (Rat) (pPM-C-HA)
PV302236	ABM	500 ng	EUR 603

RPL34 Protein Vector (Rat) (pPM-C-His)
PV302237	ABM	500 ng	EUR 603

RPL34 Protein Vector (Mouse) (pPB-C-His)
PV225398	ABM	500 ng	EUR 603

RPL34 Protein Vector (Mouse) (pPB-N-His)
PV225399	ABM	500 ng	EUR 603

RPL34 Protein Vector (Mouse) (pPM-C-HA)
PV225400	ABM	500 ng	EUR 603

RPL34 Protein Vector (Mouse) (pPM-C-His)
PV225401	ABM	500 ng	EUR 603

RPL34 Protein Vector (Mouse) (pPB-C-His)
PV225402	ABM	500 ng	EUR 603

RPL34 Protein Vector (Mouse) (pPB-N-His)
PV225403	ABM	500 ng	EUR 603