RPL34

RPL34 antibody

70R-33954 100 ug
EUR 327
Description: Rabbit polyclonal RPL34 antibody

RPL34 Antibody

ABD3708 100 ug
EUR 438

RPL34 Antibody

34356-100ul 100ul
EUR 252

RPL34 Antibody

34356-50ul 50ul
EUR 187

RPL34 siRNA

20-abx931960
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL34 siRNA

20-abx931961
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL34 Antibody

DF3708 200ul
EUR 304
Description: RPL34 Antibody detects endogenous levels of total RPL34.

RPL34 Antibody

1-CSB-PA003987
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

RPL34 Antibody

CSB-PA299301-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

RPL34 Antibody

CSB-PA299301-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

RPL34 Antibody

1-CSB-PA020243LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-RPL34

YF-PA24611 50 ul
EUR 334
Description: Mouse polyclonal to RPL34

RPL34 Conjugated Antibody

C34356 100ul
EUR 397

RPL34 cloning plasmid

CSB-CL020243HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 354
  • Sequence: atggtccagcgtttgacataccgacgtaggctttcctacaatacagcctctaacaaaactaggctgtcccgaacccctggtaatagaattgtttacctttataccaagaaggttgggaaagcaccaaaatctgcatgtggtgtgtgcccaggcagacttcgaggggttcgtgctgt
  • Show more
Description: A cloning plasmid for the RPL34 gene.

RPL34 Antibody (HRP)

20-abx305170
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL34 Antibody (FITC)

20-abx305171
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL34 Antibody (Biotin)

20-abx305172
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL34 Polyclonal Antibody

A63350 100 µg
EUR 570.55
Description: The best epigenetics products

RPL34 Rabbit pAb

A15716-100ul 100 ul
EUR 308

RPL34 Rabbit pAb

A15716-200ul 200 ul
EUR 459

RPL34 Rabbit pAb

A15716-20ul 20 ul
EUR 183

RPL34 Rabbit pAb

A15716-50ul 50 ul
EUR 223

Human RPL34 Antibody

32819-05111 150 ug
EUR 261

RPL34 Blocking Peptide

DF3708-BP 1mg
EUR 195

Anti-RPL34 antibody

STJ118176 100 µl
EUR 277

Mouse RPL34 shRNA Plasmid

20-abx976612
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL34 shRNA Plasmid

20-abx954147
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL34 protein (His tag)

80R-3042 100 ug
EUR 327
Description: Purified recombinant RPL34 protein (His tag)

RPL34 Antibody, HRP conjugated

1-CSB-PA020243LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL34 Antibody, FITC conjugated

1-CSB-PA020243LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL34 Antibody, Biotin conjugated

1-CSB-PA020243LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL34. Recognizes RPL34 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL34 Recombinant Protein (Human)

RP026974 100 ug Ask for price

RPL34 Recombinant Protein (Rat)

RP226673 100 ug Ask for price

RPL34 Recombinant Protein (Mouse)

RP169046 100 ug Ask for price

RPL34 Recombinant Protein (Mouse)

RP169049 100 ug Ask for price

Ribosomal Protein L34 (RPL34) Antibody

20-abx329438
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L34 (RPL34) Antibody

abx218301-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Ribosomal Protein L34 (RPL34) Antibody

abx332300-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ribosomal Protein L34 (RPL34) Antibody

20-abx305169
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL34 Polyclonal Antibody, HRP Conjugated

A63351 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL34 Polyclonal Antibody, FITC Conjugated

A63352 100 µg
EUR 570.55
Description: fast delivery possible

RPL34 Polyclonal Antibody, Biotin Conjugated

A63353 100 µg
EUR 570.55
Description: reagents widely cited

Human RPL34 Antibody (Biotin Conjugate)

32819-05121 150 ug
EUR 369

RPL34 ORF Vector (Human) (pORF)

ORF008992 1.0 ug DNA
EUR 95

Rpl34 ORF Vector (Mouse) (pORF)

ORF056350 1.0 ug DNA
EUR 506

Rpl34 ORF Vector (Mouse) (pORF)

ORF056351 1.0 ug DNA
EUR 506

Rpl34 ORF Vector (Rat) (pORF)

ORF075559 1.0 ug DNA
EUR 506

Rpl34-ps1 Recombinant Protein (Mouse)

RP169052 100 ug Ask for price

Anti-RPL34/Ribosomal Protein L34 Antibody

A08190 100ul
EUR 397
Description: Rabbit Polyclonal RPL34/Ribosomal Protein L34 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Human RPL34 AssayLite Antibody (FITC Conjugate)

32819-05141 150 ug
EUR 428

Human RPL34 AssayLite Antibody (RPE Conjugate)

32819-05151 150 ug
EUR 428

Human RPL34 AssayLite Antibody (APC Conjugate)

32819-05161 150 ug
EUR 428

Human RPL34 AssayLite Antibody (PerCP Conjugate)

32819-05171 150 ug
EUR 471

RPL34 sgRNA CRISPR Lentivector set (Human)

K1970201 3 x 1.0 ug
EUR 339

Rpl34 sgRNA CRISPR Lentivector set (Mouse)

K4494401 3 x 1.0 ug
EUR 339

Rpl34 sgRNA CRISPR Lentivector set (Rat)

K6238301 3 x 1.0 ug
EUR 339

Rpl34-ps1 ORF Vector (Mouse) (pORF)

ORF056352 1.0 ug DNA
EUR 506

RPL34 sgRNA CRISPR Lentivector (Human) (Target 1)

K1970202 1.0 ug DNA
EUR 154

RPL34 sgRNA CRISPR Lentivector (Human) (Target 2)

K1970203 1.0 ug DNA
EUR 154

RPL34 sgRNA CRISPR Lentivector (Human) (Target 3)

K1970204 1.0 ug DNA
EUR 154

Rpl34 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4494402 1.0 ug DNA
EUR 154

Rpl34 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4494403 1.0 ug DNA
EUR 154

Rpl34 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4494404 1.0 ug DNA
EUR 154

Rpl34-ps1 sgRNA CRISPR Lentivector set (Mouse)

K4317101 3 x 1.0 ug
EUR 339

Rpl34 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6238302 1.0 ug DNA
EUR 154

Rpl34 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6238303 1.0 ug DNA
EUR 154

Rpl34 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6238304 1.0 ug DNA
EUR 154

RPL34 Protein Vector (Human) (pPB-C-His)

PV035965 500 ng
EUR 329

RPL34 Protein Vector (Human) (pPB-N-His)

PV035966 500 ng
EUR 329

RPL34 Protein Vector (Human) (pPM-C-HA)

PV035967 500 ng
EUR 329

RPL34 Protein Vector (Human) (pPM-C-His)

PV035968 500 ng
EUR 329

Recombinant Human RPL34 Protein, His, E.coli-1mg

QP13347-1mg 1mg
EUR 2757

Recombinant Human RPL34 Protein, His, E.coli-20ug

QP13347-20ug 20ug
EUR 201

Recombinant Human RPL34 Protein, His, E.coli-5ug

QP13347-5ug 5ug
EUR 155

RPL34 Ribosomal Protein L34 Human Recombinant Protein

PROTP49207 Regular: 20ug
EUR 317
Description: RPL34 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 140 amino acids (1-117) and having a molecular mass of 15.7kDa.;RPL34 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL34 Protein Vector (Rat) (pPB-C-His)

PV302234 500 ng
EUR 603

RPL34 Protein Vector (Rat) (pPB-N-His)

PV302235 500 ng
EUR 603

RPL34 Protein Vector (Rat) (pPM-C-HA)

PV302236 500 ng
EUR 603

RPL34 Protein Vector (Rat) (pPM-C-His)

PV302237 500 ng
EUR 603

RPL34 Protein Vector (Mouse) (pPB-C-His)

PV225398 500 ng
EUR 603

RPL34 Protein Vector (Mouse) (pPB-N-His)

PV225399 500 ng
EUR 603

RPL34 Protein Vector (Mouse) (pPM-C-HA)

PV225400 500 ng
EUR 603

RPL34 Protein Vector (Mouse) (pPM-C-His)

PV225401 500 ng
EUR 603

RPL34 Protein Vector (Mouse) (pPB-C-His)

PV225402 500 ng
EUR 603

RPL34 Protein Vector (Mouse) (pPB-N-His)

PV225403 500 ng
EUR 603