GNGT2

GNGT2 siRNA

20-abx918209
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNGT2 antibody

70R-3637 50 ug
EUR 467
Description: Rabbit polyclonal GNGT2 antibody raised against the middle region of Gngt2

GNGT2 Antibody

47622-100ul 100ul
EUR 252

GNGT2 Antibody

1-CSB-PA009622LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

GNGT2 Conjugated Antibody

C47622 100ul
EUR 397

GNGT2 cloning plasmid

CSB-CL009622HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 210
  • Sequence: atggcccaggatctcagcgagaaggacctgttgaagatggaggtggagcagctgaagaaagaagtgaaaaacacaagaattccgatttccaaagcgggaaaggaaatcaaggagtacgtggaggcccaagcaggaaacgatccttttctcaaaggcatccctgaggacaagaatcc
  • Show more
Description: A cloning plasmid for the GNGT2 gene.

GNGT2 Antibody (HRP)

20-abx304027
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNGT2 Antibody (FITC)

20-abx304028
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNGT2 Antibody (Biotin)

20-abx304029
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNGT2 Polyclonal Antibody

A59270 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNGT2 Rabbit pAb

A13992-100ul 100 ul
EUR 308

GNGT2 Rabbit pAb

A13992-200ul 200 ul
EUR 459

GNGT2 Rabbit pAb

A13992-20ul 20 ul
EUR 183

GNGT2 Rabbit pAb

A13992-50ul 50 ul
EUR 223

GNGT2 Rabbit pAb

A9818-100ul 100 ul
EUR 308

GNGT2 Rabbit pAb

A9818-200ul 200 ul
EUR 459

GNGT2 Rabbit pAb

A9818-20ul 20 ul
EUR 183

GNGT2 Rabbit pAb

A9818-50ul 50 ul
EUR 223

GNGT2 Blocking Peptide

33R-4362 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNGT2 antibody, catalog no. 70R-3637

pCMV-SPORT6-GNGT2

PVT12817 2 ug
EUR 391

Anti-GNGT2 antibody

STJ111860 100 µl
EUR 277
Description: Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene.

Anti-GNGT2 antibody

STJ115927 100 µl
EUR 277
Description: Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene.

Bovine GNGT2 ELISA KIT

ELI-21492b 96 Tests
EUR 928

Mouse Gngt2 ELISA KIT

ELI-27210m 96 Tests
EUR 865

Canine GNGT2 ELISA KIT

ELI-47376d 96 Tests
EUR 928

Human GNGT2 ELISA KIT

ELI-32428h 96 Tests
EUR 824

Mouse GNGT2 shRNA Plasmid

20-abx970603
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNGT2 shRNA Plasmid

20-abx951864
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNGT2 Antibody, HRP conjugated

1-CSB-PA009622LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNGT2 Antibody, FITC conjugated

1-CSB-PA009622LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNGT2 Antibody, Biotin conjugated

1-CSB-PA009622LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNGT2. Recognizes GNGT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNGT2 Recombinant Protein (Human)

RP013561 100 ug Ask for price

GNGT2 Recombinant Protein (Rat)

RP203039 100 ug Ask for price

GNGT2 Recombinant Protein (Mouse)

RP139049 100 ug Ask for price

GNGT2 Recombinant Protein (Mouse)

RP139052 100 ug Ask for price

GNGT2 Polyclonal Antibody, Biotin Conjugated

A59271 100 µg
EUR 570.55
Description: fast delivery possible

GNGT2 Polyclonal Antibody, FITC Conjugated

A59272 100 µg
EUR 570.55
Description: reagents widely cited

GNGT2 Polyclonal Antibody, HRP Conjugated

A59273 100 µg
EUR 570.55
Description: Ask the seller for details

GNGT2 ORF Vector (Human) (pORF)

ORF004521 1.0 ug DNA
EUR 95

Gngt2 ORF Vector (Rat) (pORF)

ORF067681 1.0 ug DNA
EUR 506

Gngt2 ORF Vector (Mouse) (pORF)

ORF046351 1.0 ug DNA
EUR 506

Gngt2 ORF Vector (Mouse) (pORF)

ORF046352 1.0 ug DNA
EUR 506

GNGT2 sgRNA CRISPR Lentivector set (Human)

K0878201 3 x 1.0 ug
EUR 339

Gngt2 sgRNA CRISPR Lentivector set (Mouse)

K4579001 3 x 1.0 ug
EUR 339

Gngt2 sgRNA CRISPR Lentivector set (Rat)

K6576801 3 x 1.0 ug
EUR 339

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0878202 1.0 ug DNA
EUR 154

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0878203 1.0 ug DNA
EUR 154

GNGT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0878204 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4579002 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4579003 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4579004 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6576802 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6576803 1.0 ug DNA
EUR 154

Gngt2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6576804 1.0 ug DNA
EUR 154

GNGT2 Protein Vector (Mouse) (pPB-C-His)

PV185402 500 ng
EUR 603

GNGT2 Protein Vector (Mouse) (pPB-N-His)

PV185403 500 ng
EUR 603

GNGT2 Protein Vector (Mouse) (pPM-C-HA)

PV185404 500 ng
EUR 603

GNGT2 Protein Vector (Mouse) (pPM-C-His)

PV185405 500 ng
EUR 603

GNGT2 Protein Vector (Mouse) (pPB-C-His)

PV185406 500 ng
EUR 603

GNGT2 Protein Vector (Mouse) (pPB-N-His)

PV185407 500 ng
EUR 603