
Katalognummer: 399 - CSB-CL002712HU-10ug
Produktkategori: Företag och industri > Vetenskap och laboratorium
Storlek: 10ug
| Additional information | Formulation: 10 μg plasmid + 200μl Glycerol; Length: 264; Sequence: atgtattgcctccagtggctgctgcccgtcctcctcatccccaagcccctcaaccccgccctgtggttcagccactccatgttcatgggcttctacctgctcagcttcctcctggaacggaagccttgcacaatttgtgccttggttttcctggcagccctgttccttatctgctatagctgctggggaaactgtttcctgtaccactgctccgattccccgcttccagaatcggcgcatgatcccggcgttgtgggcacctaa |
|---|---|
| Storage and shipping | Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing. |

By: Author , 2 Comment
3 March 2026

By: Author , 2 Comment
30 January 2026

By: Author , 2 Comment
23 August 2025

By: Author , 2 Comment
16 August 2025